Sampling and Analytical Methodology:
\nGenomic DNA was extracted from Baltic Sea Basin sediments using FastDNA\u00ae Spin Kit for Soil
\n(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
\nprimers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
\nbelow 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
\nfor all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
\nBioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
\ngene PCR products from plasmids containing amplified partial 16S genes were used as standards.
\n
\u00a0
\n
Primers Used:
\n
\nPrimer name Sequence (5' - 3') Target Reference\nBac340f TCCTACGGGAGGCAGCAGT Bacteria Nadkarni et al., 2002\nBac 515r CGTATTACCGCGGCTGCTGGCAC Bacteria Nadkarni et al., 2002\nArch915f GTGCTCCCCCGCCAATTCCT Archaea Kubo et al., 2012\nArch1059r GCCATGCACCWCCTCT Archaea Kubo et al., 2012\nANME1-628f GCT TTC AGG GAA TAC TGC ANME-1 Lloyd et al., 2011\nANME1-830r TCG CAG TAA TGC CAA CAC ANME-1 Lloyd et al., 2011\nMCG528f CGGTAATACCAGCTCTCCGAG Kubo et al., 2012\nMCG732r CGCGTTCTAGCCGACAGC Kubo et al., 2012\n
\u00a0
\n
Primers used from the following publications:
\nArchaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments
\n
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
\n
Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea
Quantitative PCR data from sediment samples
\n
Locations:
\nSite 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C (Bornholm Basin).
\nSubsurface samples as deep as 85 meters below the Baltic Sea floor.
Data Processing:
\nAbsolute quantification was calculated by converting Ct values of samples into copy numbers per
\nmicroliter of DNA with the linear equation produced by the standard curve with R2 greater than 0.95.
\nThe quantification limit was defined as having fluorescence threshold cycle numbers (Ct) well within
\nthose of the simultaneously-run standard curve and being at least 3 Ct below the non-template control
\nCt.
\n
BCO-DMO Processing Notes
\n- Generated from original file \"qPCR Exp IODP 347.xlsx, sheet: qPCR\" contributed by Joy Buongiorno
\n- Parameter names edited to conform to BCO-DMO naming convention found at Choosing Parameter Name
\n- Latitude and Longitude for sample inserted from Sites data
\n- \"nd\" (no data) inserted into blank cells