Dataset: qPCR
Deployment: IODP-347

Quantitative PCR data from sediment samples

Principal Investigator:

Karen G. Lloyd (University of Tennessee Knoxville, UTK)

Co-Principal Investigator:

Andrew Steen (University of Tennessee Knoxville, UTK)

Contact:

Karen G. Lloyd (University of Tennessee Knoxville, UTK)

BCO-DMO Data Manager:

Stephen R. Gegg (Woods Hole Oceanographic Institution, WHOI BCO-DMO)

Project:

Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea (IODP-347 Microbial Quantification)

Current State:

Preliminary and in progress

Version:

25 March 2016

Deployment Synonyms:

IODP Expedition 347

Version Date:

2016-03-25

Data URL:

https://www.bco-dmo.org/dataset-deployment/641364/data

Expand/Collapse All

Description

Quantitative PCR data from sediment samples

Locations:
Site 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C (Bornholm Basin).
Subsurface samples as deep as 85 meters below the Baltic Sea floor.

Methods & Sampling

Dataset acquisition description

Sampling and Analytical Methodology:
Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

Primers Used:

Primer name     Sequence (5' - 3')           Target          Reference
Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002
Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002
Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012
Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012
ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011
ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011
MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012
MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012

Primers used from the following publications:
Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments

Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set

Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea

Data Processing Description

Dataset Processing Description

Data Processing:
Absolute quantification was calculated by converting Ct values of samples into copy numbers per
microliter of DNA with the linear equation produced by the standard curve with R2 greater than 0.95.
The quantification limit was defined as having fluorescence threshold cycle numbers (Ct) well within
those of the simultaneously-run standard curve and being at least 3 Ct below the non-template control
Ct.

BCO-DMO Processing Notes
- Generated from original file "qPCR Exp IODP 347.xlsx, sheet: qPCR" contributed by Joy Buongiorno
- Parameter names edited to conform to BCO-DMO naming convention found at Choosing Parameter Name
- Latitude and Longitude for sample inserted from Sites data
- "nd" (no data) inserted into blank cells

More information about this dataset deployment

Funding

Award Number	Funding Source
OCE-1431598	NSF Division of Ocean Sciences

Instruments

Thermal Cycler

Supplied Name: BioRad iQ5

Supplied Description:

Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

BioRad iQ5

Instrument Type

Generic Name: Thermal Cycler

Generic Description:

A thermal cycler or "thermocycler" is a general term for a type of laboratory apparatus, commonly used for performing polymerase chain reaction (PCR), that is capable of repeatedly altering and maintaining specific temperatures for defined periods of time. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. They can also be used to facilitate other temperature-sensitive reactions, including restriction enzyme digestion or rapid diagnostics.

(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)

Thermal Cycler

Supplied Name: FastDNA® Spin Kit for Soil

Supplied Description:

FastDNA® Spin Kit for Soil

Instrument Type

Generic Name: Thermal Cycler

Generic Description:

(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)

Parameters

Supplied Name	Supplied description	Supplied Units	Standard Name
Identifier	Sample Identifier	text	sample
Latitude	Site Latitude (South is negative)	decimal degrees	lat
Longitude	Site Longitude (West is negative)	decimal degrees	lon
Depth	Depth of sample in core	meters	depth_core
Archaea_replicate_1	Archaea replicate 1 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
Archaea_replicate_2	Archaea replicate 2 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
Bacteria_replicate_1	Bacteria replicate 1 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
Bacteria_replicate_2	Bacteria replicate 2 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
ANME1_replicate_1	ANME1 replicate 1 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
ANME1_replicate_2	ANME1 replicate 2 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
MCG_replicate_1	MCG replicate 1 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term
MCG_replicate_2	MCG replicate 2 (Units are copies of target DNA per microliter of DNA)	copies/uL	no_bcodmo_term

Database

Contribute Data

Dataset: qPCR
Deployment: IODP-347

Dataset acquisition description

Dataset Processing Description

Database

Contribute Data

Dataset: qPCRDeployment: IODP-347

Dataset acquisition description

Dataset Processing Description

Dataset: qPCR
Deployment: IODP-347