Niskin bottle

A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc.

CTD Sea-Bird SBE 911plus

The Sea-Bird SBE 911 plus is a type of CTD instrument package for continuous measurement of conductivity, temperature and pressure. The SBE 911 plus includes the SBE 9plus Underwater Unit and the SBE 11plus Deck Unit (for real-time readout using conductive wire) for deployment from a vessel. The combination of the SBE 9 plus and SBE 11 plus is called a SBE 911 plus. The SBE 9 plus uses Sea-Bird's standard modular temperature and conductivity sensors (SBE 3 plus and SBE 4). The SBE 9 plus CTD can be configured with up to eight auxiliary sensors to measure other parameters including dissolved oxygen, pH, turbidity, fluorescence, light (PAR), light transmission, etc.). more information from Sea-Bird Electronics

2007-04-18

2006-06-18

Leg 1 of the cruise began in Ft. Pierce FL with a rapid transit to Bridgetown, Barbados and two hydrostations (001-002) en route. Leg 2 extended from Barbados to Mindelo, Cape Verde, with nine hydrostations (003-010, 012). Leg 3 included a run south to the equator, then northwestward to Barbados with eleven hydrostations (013-023).

Methods & Sampling
Samples were collected during a cruise of the R/V Seward Johnson from 18 June to 25 July 2006. The cruise originated in Fort Pierce, Florida (27.44°N, 80.34°W), transited southeast to Barbados (13.05°N, 59.30°W), then east across the Atlantic Ocean to the Cape Verde Islands (15.02°N, 23.34°W), southwest to sampling station 17 at the equator (0.08°N, 34.99°W), and northwest to Barbados (see figure). Over 150 seawater samples were collected at stations 1 through 23 along the cruise track using Niskin bottles mounted on a conductivity-temperature-depth (CTD) rosette sampler. At each station, seawater samples were collected at 8 depths between 5 and 200 m to determine concentrations of chl a, inorganic nutrients and specific cyanobacterial nifH phylotypes. N2 fixation rates of small diazotrophs were measured at four depths at all stations but 6, 7 and 22. Fewer depths were sampled at stations 2, 22 and 23, and no samples were collected at station 11.

Processing Description
DNA extraction The Niskin bottles were drained into acid washed polycarbonate bottles, and then the seawater was filtered through sterile polypropylene filter holders using a peristaltic pump. Two litres of seawater from each depth were serially filtered through a 25 mm diameter, 10 um pore-size polyester filter (GE Osmonics, Minnetonka, MN) and a 25 mm, 0.2 um poresize Supor filter (Pall Corporation, Port Washington, NY, USA). Each filter was then stored in a polypropylene microcentrifuge tube, which contained 500 ul of Tris EDTA buffer (Ambion, Foster City, CA, USA) plus an approximate 0.2 g mixture of 0.1 mm and 0.5 mm diameter autoclaved glass beads (BioSpec Products, Bartlesville, OK, USA). The samples were immediately flash frozen in liquid nitrogen and subsequently stored frozen at -80°C until processed for nucleic acid extraction. DNA was extracted from the samples using the modified DNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA) protocol detailed in Moisander and colleagues (2008). However, during the final elution step, the samples were eluted twice with 25 ul of Buffer AE instead of 100 ul. The extracted DNA was stored at -20°C. Quantitative PCR A qPCR method using a TaqMan 5'-fluorogenic exonuclease assay was used to investigate the abundance and distribution of several nifH cyanobacterial sequence types, called nifH phylotypes. Probes were 5' labelled with the fluorescent reporter FAM (6-carboxyfluorescein) and 3' labelled with the quenching dye TAMRA (6-carboxytetramethylrhodamine). TaqMan oligonucleotide primers and specific fluorogenic probes were used to target the nifH gene of three unicellular cyanobacteria (groups A, B and C, also known as UCYN-A, UCYN-B and UCYN-C) and Trichodesmium spp., and the host-specific nifH sequences of three diatom-cyanobiont symbioses (H-R, R-R and C-C) (Table 4) (Church et al., 2005a; Church et al., 2005b; Foster et al., 2007). The cyanobionts associated with each type of diatom have been designated, based of nifH sequences, as het-1 (H-R), het-2 (R-R) and het-3 (C-C). The primer and probe sets for the diatom-cyanobiont symbioses were used to analyse extracts from the > 10 um size fraction of each sample, whereas the primer and probe sets for unicellular cyanobacteria were used to analyse extracts from the < 10 um size fraction (0.2 um to 10 um). The Trichodesmium primer and probe sets were run on extracts from both size fractions of each sample. The qPCR reactions were prepared in 96-well optical reaction plates with optical caps (Applied Biosystems, Foster City, CA, USA) and run on a ABI 7500 Real-time PCR System (Applied Biosystems) with the following thermocycling settings: 50°C for 2 min, 95°C for 10 min, and then 45 cycles of 95°C for 15 s followed by 60°C for 1 min. The sample reactions (25 ul) were run in triplicate and contained 12.5 ul of 2 x TaqMan Mastermix (Applied Biosystems), 8 ul of 5 kD filtered nuclease-free water (Ambion), 1 ull each of the forward and reverse primers (0.4 uM final concentration), 0.5 ul of fluorogenic TaqMan probe (0.2 uM final concentration) and 2 ul of template DNA (ranging from 0.05 to 161.27 ng DNA). Controls without any DNA target (no template controls) contained 2 ul of 5 kD filtered nuclease-free water (Ambion) instead of the template DNA, and were run on each plate to check for contamination. Linearized recombinant plasmids containing the nifH gene targets were used as standards for qPCR by making a dilution series covering 8 orders of magnitude (100–107 nifH gene copies per reaction), and the full series was run on each plate. The nifH gene copies l-1 were calculated for each nifH target set using linear regression parameters fit to a plot of cycle threshold (Ct) versus log gene copy for the standards run on each plate. The average efficiencies of the qPCR reactions for each of the assays were 102 ± 2% for UCYN-A, 102 ± 3% for UCYN-B, 98 ± 3% for Trichodesmium sp., 93 ± 3% for H-R and 101 ± 3% for R-R. Each sample was tested for inhibition using one primer/ probe set by spiking the qPCR reaction with a standard of 104 nifH gene copies per reaction, and determining the per cent inhibition using the following formula 1 - [(Ct,sample - Ct,standard)/ Ct,standard] x 100. In the few cases (less than 2% of the samples) where inhibition was observed, the sample was serially diluted until the addition of template DNA did not cause inhibition. In a majority of these cases, the extent of inhibition was minor, as non-inhibited amplification was observed after 10-fold dilutions. The LOD and limit of quantification (LOQ) have been determined empirically to be 1 and 8 nifH gene copies per reaction, respectively (data not shown). Taking into consideration the qPCR reaction volume, volume of nucleic acid extractions, and the volume of seawater filtered, this translates to a LOD of 10 nifH gene copies l-1 seawater and LOQ of 80 nifH gene copies l-1 seawater for a majority of the samples. LODs and LOQs are considerably higher for samples that needed to be diluted. Samples where amplification was observed, but the detected signal fell below the LOQ, were designated as ‘detected not quantified’ (DNQ). In order to calculate the depth-integrated nifH gene copies m-2, a sample that was below the LOD was considered to have zero nifH gene copies l-1, and a DNQ sample was assumed to have one nifH gene copy l-1. Table 4. Oligonucleotide TaqMan primers and probes used to detect the nifH phylotypes, and the corresponding target base region. Target Forward primer (5'-3') Probe Reverse primer (5'-3') UCYN-Aa AGCTATAACAACGTTTTATGCGTTGA TCTGGTGGTCCTGAGCCTGGA ACCACGACCAGCACATCCA 106–131 133–153 1 56–174 UCYN-Ba TGGTCCTGAGCCTGGAGTTG TGTGCTGGTCGTGGTAT TCTTCTAGGAAGTTGATGGAGGTGAT 138–157 160–176 178–203 UCYN-Cb ATACCAAGGAATCAAGTGTGTTGAGT CGGTGGTCCCGAGCCTGGAG ACCACGACCAGCACATCCA 106–124 133–153 156–174 H-Rb TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC 106–124 133–155 158–177 R-Ra CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC 105–124 133–155 158–177 C-Cb CGGTTTCCGTGGCGTACGTT TCTGGTGGTCCAGAACCTGGTGT AATACCACGACCAGCACAAC 106–124 133–155 133–155Trichodesmiuma GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAATCTGGTGG CGGCCAGCGCAACCTA TCCTGAGC 217–241 246–278 284–300 The probes were 5' labelled with the fluorescent reporter FAM and 3' labelled with the quenching dye TAMRA. a. Primer and probe designed by Church et al., 2005a. b. Primer and probe designed by Foster et al., 2007. BCO-DMO Processing Notes Generated from original spreadsheet contributed by Kendra Turk "Diazo_Distribution_Zehr_forBCO-DMO.xlsx", tab: SJ0609 nifH qPCR DNA BCO-DMO Edits - CRUISE (cruise id) inserted - Parameter names modified to conform to BCO-DMO convention - "nd" (BCO-DMO flag for no data) inserted into blank fields