http://lod.bco-dmo.org/id/dataset/3376
eng; USA
utf8
dataset
Highest level of data collection, from a common set of sensors or instrumentation, usually within the same research project
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
2010-10-19
ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data
ISO 19115-2:2009(E)
Abundance and distribution of diazotrophs determined via qPCR from R/V Kilo Moana KM0703, R/V Seward Johnson SJ0609 in the tropical and subtropical SW Pacific and tropical N Atlantic from 2006-2007 (DIAZOTROPHS project)
2010-10-21
publication
2010-10-21
revision
BCO-DMO Linked Data URI
2010-10-21
creation
http://lod.bco-dmo.org/id/dataset/3376
Jonathan P. Zehr
University of California-Santa Cruz
principalInvestigator
Joseph Montoya
Georgia Institute of Technology
principalInvestigator
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
publisher
Cite this dataset as: Zehr, J. P., Montoya, J. (2010) Abundance and distribution of diazotrophs determined via qPCR from R/V Kilo Moana KM0703, R/V Seward Johnson SJ0609 in the tropical and subtropical SW Pacific and tropical N Atlantic from 2006-2007 (DIAZOTROPHS project). Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 21 October 2010) Version Date 2010-10-21 [if applicable, indicate subset used]. http://lod.bco-dmo.org/id/dataset/3376 [access date]
Abundance and distribution of diazotrophs determined via qPCR Dataset Description: <p>Abundance and distribution of diazotrophs determined via qPCR</p> Methods and Sampling: <p><b>Refer to individual platform deployments</b></p>
Funding provided by Gordon and Betty Moore Foundation (GBMF) Award Number: unknown DIAZOTROPHS Moore
Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-0425363 Award URL: http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=0425363
Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-0425583 Award URL: http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=0425583
completed
Jonathan P. Zehr
University of California-Santa Cruz
831-459 4009
E&MS A438, Ocean Sciences Department 1156 High Street
Santa Cruz
CA
95064
USA
zehrj@ucsc.edu
pointOfContact
Joseph Montoya
Georgia Institute of Technology
(404) 385-0479
School of Biological Sciences EST Bldg., 311 Ferst Drive
Atlanta
GA
30332
USA
montoya@gatech.edu
pointOfContact
asNeeded
Dataset Version: 21 October 2010
Unknown
Cruise
Sample_ID
Station
Cast
Bottle
Depth
lon
lat
Filter_Size
UCYN_A_nifH_copies
UCYN_B_nifH_copies
Trichodesmium_nifH_copies
RR_het_1_nifH_copies
HR_het_2_nifH_copies
CC_het_3_nifH_copies
Niskin bottle
CTD Sea-Bird SBE 911plus
theme
None, User defined
cruise id
sample identification
station
cast
bottle
depth
longitude
latitude
filter_size
No BCO-DMO term
featureType
BCO-DMO Standard Parameters
Niskin bottle
CTD Sea-Bird SBE 911plus
instrument
BCO-DMO Standard Instruments
KM0703
SJ0609
service
Deployment Activity
Tropical and subtropical Southwest Pacific
Tropical North Atlantic
place
Locations
otherRestrictions
otherRestrictions
Access Constraints: none. Use Constraints: Please follow guidelines at: http://www.bco-dmo.org/terms-use Distribution liability: Under no circumstances shall BCO-DMO be liable for any direct, incidental, special, consequential, indirect, or punitive damages that result from the use of, or the inability to use, the materials in this data submission. If you are dissatisfied with any materials in this data submission your sole and exclusive remedy is to discontinue use.
Biology and Ecology of Newly Discovered Diazotrophs in the Open Ocean
https://www.bco-dmo.org/project/2096
Biology and Ecology of Newly Discovered Diazotrophs in the Open Ocean
<p><b>Biology and Ecology of Newly Discovered Diazotrophs in the Open Ocean</b><br /><br />
The productivity of the oceans is limited by the availability of nutrients,<br /><br />
which has implications for the fluxes of carbon between the atmosphere and<br /><br />
oceans. In a previous award the PIs found that previously unrecognized<br /><br />
N2-fixing unicellular cyanobacteria are active and abundant in oligotrophic<br /><br />
oceans. This finding has important implications for nitrogen cycling in the<br /><br />
oceans and for the role of "new" nitrogen in carbon fixation.<br /><br /><br /><br />
The PIs will address three major issues:<br /><br />
First, there are at least two distinct groups of cyanobacteria that appear<br /><br />
to be separated in space and time, due to unknown ecological variables.<br /><br /><br /><br />
Second, the geographic distribution and factors controlling the distribution<br /><br />
are unknown, so it is not clear how these organisms should be included in<br /><br />
biogeochemical models.<br /><br /><br /><br />
Finally, one of the groups of cyanobacteria appears to fix N2 during the day,<br /><br />
which revives the enigma of simultaneous nitrogen fixation and photosynthesis<br /><br />
that was previously limited to discussions of Trichodesmium.<br /><br /><br /><br /><br /><b>PUBLICATIONS PRODUCED AS A RESULT OF THIS RESEARCH</b><br /><br />
Burns, J.A., Zehr, J.P., Montoya, J P, Kustka, A.B., and Capone, D. G.. "Effect of<br /><br />
EDTA addtiions on natural Trichodesmium spp. (CYANOPHYTA) populations," Journal of<br /><br />
Phycology, v.42, 2006, p. 900.<br /><br /><br /><br />
Campbell, L, E.J. Carpenter, J.P. Montoya, A.B. Kustka, D.G. Capone. "Picoplankton<br /><br />
community structure within and outside a Trichodesmium bloom in the southwestern<br /><br />
Pacific Ocean," Vie et Milieu, v.55, 2005, p. 185.<br /><br /><br /><br />
Capone, D.G., J.A. Burns, J.P. Montoya, A. Subramaniam, C. Mahaffey, T. Gunderson,<br /><br />
A.F. Michaels, and E.J. Carpenter. "Nitrogen fixation by Trichodesmium spp.: An<br /><br />
important source of new nitrogen to the tropica and subtropical North Atlantic<br /><br />
Ocean," Global Biogeochemical Cycles, v.19, 2005, p. doi:10.10.<br /><br /><br /><br />
Holl, C.M. & J.P. Montoya. "Interactions between nitrate uptake and nitrogen fixation<br /><br />
continuous cultures of the marine diazotroph Trichodesmium (Cyanophyta)," Journal of<br /><br />
Phycology, v.41, 2005, p. 1178.<br /><br /><br /><br />
Holl, C.M., T.A. Villareal, C.D. Payne, T.D. Clayton, C. Hart, J.P. Montoya.<br /><br />
"Trichodesmium in the western Gulf of Mexico: 15N2-fixation and natural abundance<br /><br />
stable isotope evidence," Limnology and Oceanography, v.52, 2007, p. 2249.<br /><br /><br /><br />
Holl, C.M., Waite, A.M., Pesant, S., Thompson, P, Montoya, J P. "Unicellular diazotrophy<br /><br />
as a source of nitrogen to Leeuwin Current coastal eddies," Deep-Sea Research I,<br /><br />
v.54, 2007, p. 1045.<br /><br /><br /><br />
Krauk, J.M, T.A. Villareal, J.A. Sohm, J.P. Montoya, and D.G. Capone. "Plasticity<br /><br />
of N:P ratios in laboratory and field populations of Trichodesmium spp.," Aquatic<br /><br />
Microbial Ecology, v.72, 2006, p. 243.<br /><br /><br /><br />
Montoya, J P, Holl, C.M., Zehr, J.P., Hansen, A., Villareal, T.A., Capone, D.G..<br /><br />
"High rates of N2-fixation by unicellular diazotrophs in the oligotrophic Pacific,"<br /><br />
Nature, v.430, 2004, p. 1027.<br /><br /><br /><br />
Montoya, J.P., M. Voss, and D.G. Capone. "Spatial variation in N2-fixation rate<br /><br />
and diazotroph activity in the Tropical Atlantic," Biogeosciences, v.4, 2007, p. 396.<br /><br /><br /><br />
Subramaniam, A, P.L. Yager, E.J. Carpenter, C. Mahaffey, K. Bjorkman, S. Cooley,<br /><br />
A. Kustka, J.P. Montoya, A. Sañudo-Wilhelmy, R. Shipe, and D.G. Capone. "Amazon River<br /><br />
enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean,"<br /><br />
Proc. Natl. Acad. Sci, v.105, 2008, p. 10460.<br /><br /><br /><br />
Waite, AM; Muhling, BA; Holl, CM; Beckley, LE; Montoya, JP; Strzelecki, J; Thompson, PA;<br /><br />
Pesant, S. "Food web structure in two counter-rotating eddies based on delta N-15 and<br /><br />
delta C-13 isotopic analyses," DEEP-SEA RESEARCH PART II-TOPICAL STUDIES IN OCEANOGRAPHY,<br /><br />
v.54, 2007, p. 1055-1075. View record at Web of Science<br /><br /><br /></p>
DIAZOTROPHS
largerWorkCitation
project
eng; USA
oceans
Tropical and subtropical Southwest Pacific; Tropical North Atlantic
2010-10-21
Tropical and Subtropical Southwest Pacific and tropical North Atlantic
0
BCO-DMO catalogue of parameters from Abundance and distribution of diazotrophs determined via qPCR from R/V Kilo Moana KM0703, R/V Seward Johnson SJ0609 in the tropical and subtropical SW Pacific and tropical N Atlantic from 2006-2007 (DIAZOTROPHS project)
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
http://lod.bco-dmo.org/id/dataset-parameter/22515.rdf
Name: Cruise
Units: text
Description: Cruise Id
http://lod.bco-dmo.org/id/dataset-parameter/22516.rdf
Name: Sample_ID
Units: integer
Description: Unique sample identifier
http://lod.bco-dmo.org/id/dataset-parameter/22517.rdf
Name: Station
Units: integer
Description: Station identifier
http://lod.bco-dmo.org/id/dataset-parameter/22518.rdf
Name: Cast
Units: integer
Description: CTD cast
http://lod.bco-dmo.org/id/dataset-parameter/22519.rdf
Name: Bottle
Units: integer
Description: Niskin bottle sampled
http://lod.bco-dmo.org/id/dataset-parameter/22520.rdf
Name: Depth
Units: meters
Description: Depth of water sample
http://lod.bco-dmo.org/id/dataset-parameter/22521.rdf
Name: lon
Units: decimal degrees
Description: longitude; negative denotes West
http://lod.bco-dmo.org/id/dataset-parameter/22522.rdf
Name: lat
Units: decimal degrees
Description: latitude; negative denotes South
http://lod.bco-dmo.org/id/dataset-parameter/22523.rdf
Name: Filter_Size
Units: um
Description: size fraction associated with sample in microns (um); if 10 then data refers to the size fraction >10 microns; if 0.2 then the data refers to the size fraction between 0.2 and 10 microns
http://lod.bco-dmo.org/id/dataset-parameter/22524.rdf
Name: UCYN_A_nifH_copies
Units: L-1
Description: number of nifH genes per liter of seawater from uncultivated unicellular cyanobacteria group A (UCYN-A) as determined using qPCR; undetected (UD) or detected not quantified (DNQ)
http://lod.bco-dmo.org/id/dataset-parameter/22525.rdf
Name: UCYN_B_nifH_copies
Units: L-1
Description: number of nifH genes per liter of seawater from unicellular cyanobacteria group B (UCYN-B); Crocosphaera; as determined using qPCR
http://lod.bco-dmo.org/id/dataset-parameter/22526.rdf
Name: Trichodesmium_nifH_copies
Units: L-1
Description: number of nifH genes per liter of seawater from filamentous; non-heterocystous cyanobacteria Trichodesmium as determined using qPCR; undetected (UD) or detected not quantified (DNQ)
http://lod.bco-dmo.org/id/dataset-parameter/22527.rdf
Name: RR_het_1_nifH_copies
Units: L-1
Description: number of nifH genes per liter of seawater from heterocystous cyanobacteria Richelia associated with Rhizosolenia as determined using qPCR; undetected (UD) or detected not quantified (DNQ)
http://lod.bco-dmo.org/id/dataset-parameter/22528.rdf
Name: HR_het_2_nifH_copies
Units: L-1
Description: number of nifH genes per liter of seawater from heterocystous cyanobacteria Richelia associated with Hemiaulus as determined using qPCR; undetected (UD) or detected not quantified (DNQ)
http://lod.bco-dmo.org/id/dataset-parameter/22529.rdf
Name: CC_het_3_nifH_copies
Units: L-1
Description: number of nifH genes per liter of seawater from heterocystous cyanobacteria Calothrix associated with Chaetoceros as determined using qPCR; undetected (UD) or detected not quantified (DNQ)
GB/NERC/BODC > British Oceanographic Data Centre, Natural Environment Research Council, United Kingdom
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
41674
https://datadocs.bco-dmo.org/file/M77XqrKI59wgAV/Diazo_Distr.csv
Diazo_Distr.csv
Primary data file for dataset ID 3376
download
https://www.bco-dmo.org/dataset/3376/data/download
download
onLine
dataset
<p><b>Refer to individual platform deployments</b></p>
from Cruise: KM0703 <p><b>Materials and Methods</b><br />
Water samples were collected from the R/V Kilo Moana (cruise KM0703) in 18 March - 14 April, 2007.</p>
<p><b>Quantification of diazotrophs.</b> Diazotroph abundances were determined using quantitative PCR (qPCR) targeting the <i>nifH</i> gene. Samples for DNA were collected with Niskin bottles from 8 depths at each station. Four to five liters of water was filtered first through 10 um (Osmonics) and next through 0.2 um Supor (Pall-Gelman) filters using a peristaltic pump. Filters were placed in bead beater tubes with 0.1 g sterile glass beads and immediately frozen in liquid N. Nucleic acid samples were kept in liquid N or liquid N fumes during the cruise and transportation to the University of California Santa Cruz where they were stored at –80ºC. DNA was extracted using a modified Qiagen Plant Minikit protocol (S<i>1</i>).<br />
<br />
A new qPCR primer-probe set (pps) was designed, tested and applied targeting <i>Crocosphaera watsonii</i>. The pps was designed using Primer Express software (Applied Biosystems). The pps has 100% nucleotide identity with <i>C. watsonii</i> WH8501 draft genome and an environmental clone DQ118216 (clone HT3312A10) from station ALOHA in the North Pacific Ocean. Specificity of the new primer probe set was tested against plasmid dilution series of 1-10<sup>7</sup> <i>nifH</i> copies from other diazotroph groups including UCYN-A, <i>Trichodesmium</i>, symbiotic heterocystous cyanobacteria Het-1, Het-2, and Het-3. None of these diazotrophs were detected by the <i>Crocosphaera</i> primer probe set and all no template controls (blanks) were negative. QPCR TaqMan primer-probe sets from previous studies were used to target UCYN-A, the filamentous cyanobacterium <i>Trichodesmium </i>spp<i>.</i>, heterocystous filamentous cyanobacterium <i>Richelia</i> associated with the diatom <i>Rhizosolenia</i> (Het-1) (S<i>2-3</i>), <i>Richelia</i> symbiont associated with the diatom <i>Hemiaulus</i> (Het-2) (S<i>4-5</i>), and a γ-Proteobacterial diazotroph for clone 24774A11 (GenBank accession number EU052413) (probe γ-Prot 24774A11) (S<i>1</i>). The probes were 5’FAM and 3’TAMRA labeled (Sigma Genosys). For qPCR template, DNA from 0.2-10 um size fraction was either diluted 1:10 (vol:vol) or used undiluted, and DNA extracted from the >10 um size fraction was used undiluted as the template. The 0-10 um size fraction samples were processed for UCYN-A,<i> Crocosphaera</i>, and y-Prot 24774A11, and all other targets except UCYN-A and γ-Prot 24774A11 were detected in >10 um size fraction samples. Gene copy abundances of <i>Crocosphaera</i> in the two size fractions were pooled to obtain total abundance. Three surface samples (5, 15, and 30 m) from station 25 were omitted as outliers in the <i>Crocosphaera</i> dataset (total n=98); low density surface water lens influenced vertical distributions at this station. Two uL of template DNA was added into the reaction mix at a 25 uL final volume that consisted of 12.5 uL ABI TaqMan Gene Expression mix, forward and reverse primers at 0.4 uM final concentration, and 0.2 uM final concentration of the TaqMan probe, and the volume was adjusted to 25 uL with water. Standards were included in duplicate with each set of samples run on the qPCR instrument, and composed of a dilution series with a range of 1 to 10<sup>7</sup> <i>nifH</i> gene copies of linearized plasmid (pGEM-T, Promega) with the target insert. Four no template controls were run with each set of samples. Inhibition tests were carried out for each DNA sample by adding to the reaction mix two ul sample and two μl of standard containing 10<sup>4</sup> or 10<sup>5</sup> gene copies. QPCR was carried out using an ABI 7500 Real time PCR instrument (Applied Biosystems). The qPCR run conditions were 2 min at 50°C, then 45 cycles of 15 s at 95°C and 1 min at 60°C. The number of gene copies per sample was calculated as described in Short and Zehr (S<i>6</i>). One gene copy per reaction was determined as the limit of detection and 8 gene copies per reaction was determined as a limit of quantification (DNQ, "detected but not quantifiable"). In data analysis, DNQ was replaced with 1 gene copy L<sup>-1</sup>. In regression analyses, values from the upper mixed layer (UML) were included. Determination of the bottom of the UML is approximate, therefore values below UML were also included if UCYN-A or <i>Crocosphaera</i> abundance was in the same order of magnitude or higher than that in the UML.</p>
from Cruise: SJ0609 <p>Samples were collected during a cruise of the R/V Seward Johnson from 18 June to 25 July 2006. The cruise originated in Fort Pierce, Florida (27.44°N, 80.34°W), transited southeast to Barbados (13.05°N, 59.30°W), then east across the Atlantic Ocean to the Cape Verde Islands (15.02°N, 23.34°W), southwest to sampling station 17 at the equator (0.08°N, 34.99°W), and northwest to Barbados (see figure). Over 150 seawater samples were collected at stations 1 through 23 along the cruise track using Niskin bottles mounted on a conductivity-temperature-depth (CTD) rosette sampler. At each station, seawater samples were collected at 8 depths between 5 and 200 m to determine concentrations of chl a, inorganic nutrients and specific cyanobacterial <em>nifH</em> phylotypes. N<sub>2</sub> fixation rates of small diazotrophs were measured at four depths at all stations but 6, 7 and 22. Fewer depths were sampled at stations 2, 22 and 23, and no samples were collected at station 11.</p>
<p><img alt="" src="https://datadocs.bco-dmo.org/d2/DIAZOTROPHS/SJ0609_Sampling.jpg" /></p>
Specified by the Principal Investigator(s)
<p><b>BCO-DMO Processing Notes</b><br />
Generated from original spreadsheet contributed by Kendra Turk: &quot;Diazo_Distribution_Zehr_forBCO-DMO.xlsx&quot;<br />
<br />
<b>BCO-DMO Edits</b><br />
- CRUISE (cruise ids) inserted<br />
- Parameter names modified to conform to BCO-DMO convention<br />
- &quot;nd&quot; (BCO-DMO flag for no data) inserted into blank fields<br />
- data submitted as seperate cruises combined into one dataset</p>
from Cruise: KM0703 <p><b>BCO-DMO Processing Notes</b><br />
Generated from original spreadsheet contributed by Kendra Turk<br />
"Diazo_Distribution_Zehr_forBCO-DMO.xlsx", tab: KM0703 nifH qPCR DNA<br />
<br />
<b>BCO-DMO Edits</b><br />
- CRUISE (cruise id) inserted<br />
- Parameter names modified to conform to BCO-DMO convention<br />
- "nd" (BCO-DMO flag for no data) inserted into blank fields</p>
from Cruise: SJ0609 <p><em>DNA extraction</em><br />
The Niskin bottles were drained into acid washed polycarbonate bottles, and then the seawater was filtered through sterile polypropylene filter holders using a peristaltic pump. Two litres of seawater from each depth were serially filtered through a 25 mm diameter, 10 um pore-size polyester filter (GE Osmonics, Minnetonka, MN) and a 25 mm, 0.2 um poresize Supor filter (Pall Corporation, Port Washington, NY, USA). Each filter was then stored in a polypropylene microcentrifuge tube, which contained 500 ul of Tris EDTA buffer (Ambion, Foster City, CA, USA) plus an approximate 0.2 g mixture of 0.1 mm and 0.5 mm diameter autoclaved glass beads (BioSpec Products, Bartlesville, OK, USA). The samples were immediately flash frozen in liquid nitrogen and subsequently stored frozen at -80°C until processed for nucleic acid extraction.<br />
<br />
DNA was extracted from the samples using the modified DNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA) protocol detailed in Moisander and colleagues (2008). However, during the final elution step, the samples were eluted twice with 25 ul of Buffer AE instead of 100 ul. The extracted DNA was stored at -20°C.<br />
<br />
<em>Quantitative PCR</em><br />
A qPCR method using a TaqMan 5'-fluorogenic exonuclease assay was used to investigate the abundance and distribution of several nifH cyanobacterial sequence types, called <em>nifH</em> phylotypes. Probes were 5' labelled with the fluorescent reporter FAM (6-carboxyfluorescein) and 3' labelled with the quenching dye TAMRA (6-carboxytetramethylrhodamine). TaqMan oligonucleotide primers and specific fluorogenic probes were used to target the <em>nifH</em> gene of three unicellular cyanobacteria (groups A, B and C, also known as UCYN-A, UCYN-B and UCYN-C) and <em>Trichodesmium</em> spp., and the host-specific <em>nifH</em> sequences of three diatom-cyanobiont symbioses (H-R, R-R and C-C) (Table 4) (Church <em>et al.</em>, 2005a; Church <em>et a</em>l., 2005b; Foster <em>et al</em>., 2007). The cyanobionts associated with each type of diatom have been designated, based of <em>nifH</em> sequences, as het-1 (H-R), het-2 (R-R) and het-3 (C-C). The primer and probe sets for the diatom-cyanobiont symbioses were used to analyse extracts from the > 10 um size fraction of each sample, whereas the primer and probe sets for unicellular cyanobacteria were used to analyse extracts from the < 10 um size fraction (0.2 um to 10 um). The <em>Trichodesmium</em> primer and probe sets were run on extracts from both size fractions of each sample.<br />
<br />
The qPCR reactions were prepared in 96-well optical reaction plates with optical caps (Applied Biosystems, Foster City, CA, USA) and run on a ABI 7500 Real-time PCR System (Applied Biosystems) with the following thermocycling settings: 50°C for 2 min, 95°C for 10 min, and then 45 cycles of 95°C for 15 s followed by 60°C for 1 min. The sample reactions (25 ul) were run in triplicate and contained 12.5 ul of 2 x TaqMan Mastermix (Applied Biosystems), 8 ul of 5 kD filtered nuclease-free water (Ambion), 1 ull each of the forward and reverse primers (0.4 uM final concentration), 0.5 ul of fluorogenic TaqMan probe (0.2 uM final concentration) and 2 ul of template DNA (ranging from 0.05 to 161.27 ng DNA). Controls without any DNA target (no template controls) contained 2 ul of 5 kD filtered nuclease-free water (Ambion) instead of the template DNA, and were run on each plate to check for contamination.<br />
<br />
Linearized recombinant plasmids containing the <em>nifH</em> gene targets were used as standards for qPCR by making a dilution series covering 8 orders of magnitude (10<sup>0</sup>–10<sup>7</sup> <em>nifH</em> gene copies per reaction), and the full series was run on each plate. The <em>nifH</em> gene copies l<sup>-1</sup> were calculated for each <em>nifH</em> target set using linear regression parameters fit to a plot of cycle threshold (<em>C<sub>t</sub></em>) versus log gene copy for the standards run on each plate. The average efficiencies of the qPCR reactions for each of the assays were 102 ± 2% for UCYN-A, 102 ± 3% for UCYN-B, 98 ± 3% for <em>Trichodesmium</em> sp., 93 ± 3% for H-R and 101 ± 3% for R-R.<br />
<br />
Each sample was tested for inhibition using one primer/ probe set by spiking the qPCR reaction with a standard of 10<sup>4</sup> <em>nifH</em> gene copies per reaction, and determining the per cent inhibition using the following formula 1 - [(C<sub>t,sample</sub> - C<sub>t,standard</sub>)/ Ct<sub>,standard</sub>] x 100. In the few cases (less than 2% of the samples) where inhibition was observed, the sample was serially diluted until the addition of template DNA did not cause inhibition. In a majority of these cases, the extent of inhibition was minor, as non-inhibited amplification was observed after 10-fold dilutions.<br />
<br />
The LOD and limit of quantification (LOQ) have been determined empirically to be 1 and 8 <em>nifH</em> gene copies per reaction, respectively (data not shown). Taking into consideration the qPCR reaction volume, volume of nucleic acid extractions, and the volume of seawater filtered, this translates to a LOD of 10 <em>nifH</em> gene copies l<sup>-1</sup> seawater and LOQ of 80 <em>nifH</em> gene copies l<sup>-1</sup> seawater for a majority of the samples. LODs and LOQs are considerably higher for samples that needed to be diluted. Samples where amplification was observed, but the detected signal fell below the LOQ, were designated as ‘detected not quantified’ (DNQ). In order to calculate the depth-integrated <em>nifH</em> gene copies m<sup>-2</sup>, a sample that was below the LOD was considered to have zero <em>nifH</em> gene copies l<sup>-1</sup>, and a DNQ sample was assumed to have one <em>nifH</em> gene copy l<sup>-1</sup>.</p>
<pre>
Table 4. Oligonucleotide TaqMan primers and probes used to detect the nifH phylotypes, and the corresponding target base region.
Target Forward primer (5'-3') Probe Reverse primer (5'-3')
UCYN-A<sup>a</sup> AGCTATAACAACGTTTTATGCGTTGA TCTGGTGGTCCTGAGCCTGGA ACCACGACCAGCACATCCA
106–131 133–153 156–174
UCYN-B<sup>a</sup> TGGTCCTGAGCCTGGAGTTG TGTGCTGGTCGTGGTAT TCTTCTAGGAAGTTGATGGAGGTGAT
138–157 160–176 178–203
UCYN-C<sup>b</sup> ATACCAAGGAATCAAGTGTGTTGAGT CGGTGGTCCCGAGCCTGGAG ACCACGACCAGCACATCCA
106–124 133–153 156–174
H-R<sup>b</sup> TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC
106–124 133–155 158–177
R-R<sup>a</sup> CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC
105–124 133–155 158–177
C-C<sup>b</sup> CGGTTTCCGTGGCGTACGTT TCTGGTGGTCCAGAACCTGGTGT AATACCACGACCAGCACAAC
106–124 133–155 133–155
<em>Trichodesmiuma</em> GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAATCTGGTGGCGGCCAGCGCAACCTA
TCCTGAGC
217–241 246–278 284–300
The probes were 5' labelled with the fluorescent reporter FAM and 3' labelled with the quenching dye TAMRA.
a. Primer and probe designed by Church et al., 2005a.
b. Primer and probe designed by Foster et al., 2007.
</pre>
<p><br />
<strong>BCO-DMO Processing Notes</strong><br />
Generated from original spreadsheet contributed by Kendra Turk<br />
"Diazo_Distribution_Zehr_forBCO-DMO.xlsx", tab: SJ0609 nifH qPCR DNA<br />
<br />
<strong>BCO-DMO Edits</strong><br />
- CRUISE (cruise id) inserted<br />
- Parameter names modified to conform to BCO-DMO convention<br />
- "nd" (BCO-DMO flag for no data) inserted into blank fields</p>
Specified by the Principal Investigator(s)
asNeeded
7.x-1.1
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
Niskin bottle
Niskin bottle
PI Supplied Instrument Name: Niskin bottle Instrument Name: Niskin bottle Instrument Short Name:Niskin bottle Instrument Description: A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc. Community Standard Description: http://vocab.nerc.ac.uk/collection/L22/current/TOOL0412/
CTD Sea-Bird SBE 911plus
CTD Sea-Bird SBE 911plus
PI Supplied Instrument Name: CTD Sea-Bird SBE 911plus Instrument Name: CTD Sea-Bird SBE 911plus Instrument Short Name:CTD SBE 911plus Instrument Description: The Sea-Bird SBE 911 plus is a type of CTD instrument package for continuous measurement of conductivity, temperature and pressure. The SBE 911 plus includes the SBE 9plus Underwater Unit and the SBE 11plus Deck Unit (for real-time readout using conductive wire) for deployment from a vessel. The combination of the SBE 9 plus and SBE 11 plus is called a SBE 911 plus. The SBE 9 plus uses Sea-Bird's standard modular temperature and conductivity sensors (SBE 3 plus and SBE 4). The SBE 9 plus CTD can be configured with up to eight auxiliary sensors to measure other parameters including dissolved oxygen, pH, turbidity, fluorescence, light (PAR), light transmission, etc.). more information from Sea-Bird Electronics Community Standard Description: http://vocab.nerc.ac.uk/collection/L22/current/TOOL0058/
Cruise: KM0703
KM0703
R/V Kilo Moana
Community Standard Description
International Council for the Exploration of the Sea
R/V Kilo Moana
vessel
KM0703
Jonathan P. Zehr
University of California-Santa Cruz
http://www.rvdata.us/catalog/KM0703
Report describing KM0703
Cruise: SJ0609
SJ0609
Community Standard Description
International Council for the Exploration of the Sea
R/V Seward Johnson
vessel
SJ0609
Jonathan P. Zehr
University of California-Santa Cruz
R/V Kilo Moana
Community Standard Description
International Council for the Exploration of the Sea
R/V Kilo Moana
vessel
Community Standard Description
International Council for the Exploration of the Sea
R/V Seward Johnson
vessel