http://lod.bco-dmo.org/id/dataset/565717
eng; USA
utf8
dataset
Highest level of data collection, from a common set of sensors or instrumentation, usually within the same research project
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
2015-09-08
ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data
ISO 19115-2:2009(E)
BLAST results from the Bermuda Atlantic Time Series (BATS) site collected from the R/V Atlantic Explorer cruises in Feb. and Aug. 2012 (DimBio NABE project)
2015-09-08
publication
2015-09-08
revision
BCO-DMO Linked Data URI
2015-09-08
creation
http://lod.bco-dmo.org/id/dataset/565717
Andrew E. Allen
J. Craig Venter Institute
principalInvestigator
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
publisher
Cite this dataset as: Allen, A. E. (2015) BLAST results from the Bermuda Atlantic Time Series (BATS) site collected from the R/V Atlantic Explorer cruises in Feb. and Aug. 2012 (DimBio NABE project). Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 2015-09-08) Version Date 2015-09-08 [if applicable, indicate subset used]. http://lod.bco-dmo.org/id/dataset/565717 [access date]
BLAST results from the Bermuda Atlantic Time Series (BATS) site in Feb. and Aug. 2012 Dataset Description: <p>This dataset includes the BLAST result for rDNA samples collected in February and August, 2012 in the Bermuda Atlantic Time Series (BATS) area.</p>
<p>Once the data are submitted to GenBank, accession numbers will be provided.</p>
<p><strong>Related Dataset:</strong></p>
<p><a href="http://www.bco-dmo.org/dataset/565711" target="_blank">BATS_Feb_Aug_2012_rDNA_sample_log</a></p>
<p>Processed sequences from this data set can be found at <a href="https://scripps.ucsd.edu/labs/aallen/data/" target="_blank">https://scripps.ucsd.edu/labs/aallen/data/</a> under microbial diversity data sets.</p> Methods and Sampling: <p>Oceanographic sampling:&nbsp; Water was collected with Niskin bottles mounted on a CTD rosette with integrated chlorophyll a fluorometer. Samples were collected from the mixed layer, chlorophyll max and mesopelagic. 200 L of seawater was passed through a 20 mm nytex mesh into 50L carboys cleaned with 0.1% bleach and distilled water.&nbsp; The 20 mm-filtered seawater was serially filtered through 3.0, 0.8, and 0.1 mm filters (Millipore), with rapid transfer of filters to storage buffer and -80oC as described in Rusch et al. (2007).&nbsp; Nucleic acids were extracted as previously described (Rusch et al 2007).</p>
<p>16S/18S small subunit ribosomal rDNA transcript sequencing: Approximately 500 bp of the v3v5 region of 16S rDNA gene was amplified using the nearly universal eubacterial primers 341F (5’-CCTACGGGNGGCWGCAG-3’) (Lane et al., 1985) and 926R (5’-CCGTCAATTCMTTTRAGT-3’) (Herlemann et al., 2011). Approximately 500 bp of the v4 region of the eukaryotic 18S rDNA transcript was amplified with the nearly universal primers TAReuk454FWD1 (5′-CCAGCASCYGCGGTAATTCC-3′) and TAReukREV3 (5′-ACTTTCGTTCTTGATYRA-3′) (Stoek et al., 2010). Primers were adapted for 454 sequencing by addition of FLX Titanium adapters (A adapter sequence: 5′ CCATCTCATCCCTGCGTGTCTCCGACTCAG 3′; B adapter sequence: 5′ CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3′) and incorporation of 10bp multiplex identifier (MID) barcodes to facilitate multiplexing.</p>
<p>Life Technologies AccuPrime PCR system was used to amplify the DNA. 1 µl of each sample (35-100 ng) was used in a 20 µl PCR reaction, which contained 1X AccuPrime Buffer II, .75 units of AccuPrime Taq High Fidelity, and a final primer concentration of 200 nM. A no template negative control for cDNA synthesis was used as a negative control for subsequent PCRs reactions. Cycling conditions included an initial denaturation at 95°C for 2 minutes, 30 cycles of 95°C for 20 seconds, 56°C for 30&nbsp;seconds, 72°C for 5 minutes using a Life Technologies ProFlex PCR system. 2 µl of the samples and 5 µL of the negative control were run on a 1% agarose gel at 105 V for 35 minutes. Reactions were cleaned using Ampure XP beads&nbsp;(Beckman Coulter, Brea CA). The final products were resuspended in 25 µL of Qiagen elution buffer and 2.5 µL was uses for visualization on an agarose gel. 1 µL was used to quantify the final product using LifeTechnologies’&nbsp;PicoGreen Quant-IT assay. 20 ng and 30 ng of each 16S or 18S amplicon respectively were pooled&nbsp;separately for sequencing. &nbsp;</p>
<p>Library QC, emPCR, enrichment and 454 sequencing were performed by following the vendor’s standard protocols (Roche Diagnostics) with some modifications.&nbsp; Specifically, qPCR was used to accurately estimate the number of molecules needed for emPCR using KAPA Biosystems Library Quantification Kit. Automation (BioMek FX) was used to “break” the emulsions after emPCR and butanol was used to enable easier sample handling during the breaking process. The REM e (Robotic Enrichment Module) from Roche was used to automate the bead enrichment process in the pipeline. Generally, between 10,000 and 40,000 16S and 18S sequences were recovered and analyzed for each of the samples.] &nbsp;</p>
<p><strong>References:</strong></p>
<p>Herlemann D P R, Labrenz M, Jürgens K, Bertilsson S, Waniek J J, Andersson A F (2011) Transitions in bacterial communities along the 2000 km salinity gradient of the Baltic Sea. The ISME J&nbsp; 5: 1571-1579</p>
<p>Lane D J, Pace B, Olsen G J, Stahl D A, Sogin M&nbsp; L, Pace N R (1985) Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc of the Nat Acad of Sci USA. &nbsp;82: 6955-6959</p>
<p>Stoeck T, Bass D, Nebel M, Christen, R, Jones M D M, Breiner H W, Richards T A. (2010). Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Molecular Ecology 19: 21-31.</p>
<p>Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, Yooseph S et al (2007). The Sorcerer II global ocean sampling expedition: Northwest Atlantic through Eastern Tropical Pacific. PloS Biology 5: 398-431.</p>
Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1136477 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=1136477
onGoing
Andrew E. Allen
J. Craig Venter Institute
858-200-1826
4120 Capricorn Lane
La Jolla
CA
92037
USA
aallen@jcvi.org
pointOfContact
asNeeded
Dataset Version: 2015-09-08
Unknown
taxon_1
sample
taxon_list
theme
None, User defined
taxon
sample identification
No BCO-DMO term
featureType
BCO-DMO Standard Parameters
CTD - profiler
Fluorometer
Niskin bottle
Thermal Cycler
instrument
BCO-DMO Standard Instruments
AE1203
AE1220
service
Deployment Activity
BATS
place
Locations
otherRestrictions
otherRestrictions
Access Constraints: none. Use Constraints: Please follow guidelines at: http://www.bco-dmo.org/terms-use Distribution liability: Under no circumstances shall BCO-DMO be liable for any direct, incidental, special, consequential, indirect, or punitive damages that result from the use of, or the inability to use, the materials in this data submission. If you are dissatisfied with any materials in this data submission your sole and exclusive remedy is to discontinue use.
Dimensions of Biodiversity
http://www.nsf.gov/funding/pgm_summ.jsp?pims_id=503446
Dimensions of Biodiversity
(adapted from the NSF Synopsis of Program)
Dimensions of Biodiversity is a program solicitation from the NSF Directorate for Biological Sciences. FY 2010 was year one of the program. [MORE from NSF]
The NSF Dimensions of Biodiversity program seeks to characterize biodiversity on Earth by using integrative, innovative approaches to fill rapidly the most substantial gaps in our understanding. The program will take a broad view of biodiversity, and in its initial phase will focus on the integration of genetic, taxonomic, and functional dimensions of biodiversity. Project investigators are encouraged to integrate these three dimensions to understand the interactions and feedbacks among them. While this focus complements several core NSF programs, it differs by requiring that multiple dimensions of biodiversity be addressed simultaneously, to understand the roles of biodiversity in critical ecological and evolutionary processes.
Dimensions of Biodiversity
largerWorkCitation
program
Functional diversity of marine eukaryotic phytoplankton and their contributions to the C and N cycling
https://osprey.bco-dmo.org/project/544343
Functional diversity of marine eukaryotic phytoplankton and their contributions to the C and N cycling
<p>This project will investigate the taxonomic, genetic and functional diversity of eukaryotic phytoplankton at two North Atlantic sites (subarctic and subtropical) in two seasons. The PIs will use diagnostic microarrays for community analysis based on functional genes (both DNA and RNA) and next generation sequencing (i.e., transcriptomics using 454 technology) to identify the players, both in terms of community composition and activity, and to explore the functional diversity of the natural assemblage. In order to identify which groups are active in C and N assimilation and which N source is being utilized by the different size and functional groups, both filter-separated and flow cytometry-sorted samples will be used to 1) measure 13C primary production and 15N assimilation by incubations with isotope tracers, 2) measure the natural stable N isotope signatures of different taxonomic groups and 3) link the molecular diversity to the functional diversity in C and N transformations. Using flow cytometry linked to mass spectrometry, these investigators have found an unexpectedly strong differentiation in the form of N assimilated by prokaryotes and eukaryotes, with eukaryotes being more dynamic.</p>
<p>This project will investigate the taxonomic, genetic and functional diversity of eukaryotic phytoplankton and to link this diversity and assemblage composition to the carbon and nitrogen biogeochemistry of the surface ocean. Taxonomic diversity will be investigated by identifying the components of the phytoplankton assemblages using molecular, chemical and microscope methods. Genetic diversity will be explored at several levels, including direct sequencing of clone libraries of key functional genes and metatranscriptomic sequencing and microarray analysis of size fractionated/sorted phytoplankton assemblages. Using natural abundance and tracer stable isotope methods, genetic and taxonomic diversity will be linked to functional diversity in C and N assimilation in size- fractionated and taxon-sorted populations.</p>
DimBio NABE
largerWorkCitation
project
eng; USA
biota
oceans
BATS
2015-09-08
North Atlantic Ocean, transects from southwest to northeast
0
BCO-DMO catalogue of parameters from BLAST results from the Bermuda Atlantic Time Series (BATS) site collected from the R/V Atlantic Explorer cruises in Feb. and Aug. 2012 (DimBio NABE project)
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
http://lod.bco-dmo.org/id/dataset-parameter/567273.rdf
Name: taxon_1
Units: unitless
Description: <p>higher order taxonomic group</p>
http://lod.bco-dmo.org/id/dataset-parameter/567274.rdf
Name: sample
Units: unitless
Description: <p>sample identification</p>
http://lod.bco-dmo.org/id/dataset-parameter/567275.rdf
Name: taxon_list
Units: unitless
Description: <p>BLAST id result and code?</p>
GB/NERC/BODC > British Oceanographic Data Centre, Natural Environment Research Council, United Kingdom
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
89779469
https://datadocs.bco-dmo.org/file/ZZZgK5Oh7VNApM/diversity.csv
diversity.csv
Primary data file for dataset ID 565717
download
https://osprey.bco-dmo.org/dataset/565717/data/download
download
onLine
dataset
<p>Oceanographic sampling:&nbsp; Water was collected with Niskin bottles mounted on a CTD rosette with integrated chlorophyll a fluorometer. Samples were collected from the mixed layer, chlorophyll max and mesopelagic. 200 L of seawater was passed through a 20 mm nytex mesh into 50L carboys cleaned with 0.1% bleach and distilled water.&nbsp; The 20 mm-filtered seawater was serially filtered through 3.0, 0.8, and 0.1 mm filters (Millipore), with rapid transfer of filters to storage buffer and -80oC as described in Rusch et al. (2007).&nbsp; Nucleic acids were extracted as previously described (Rusch et al 2007).</p>
<p>16S/18S small subunit ribosomal rDNA transcript sequencing: Approximately 500 bp of the v3v5 region of 16S rDNA gene was amplified using the nearly universal eubacterial primers 341F (5’-CCTACGGGNGGCWGCAG-3’) (Lane et al., 1985) and 926R (5’-CCGTCAATTCMTTTRAGT-3’) (Herlemann et al., 2011). Approximately 500 bp of the v4 region of the eukaryotic 18S rDNA transcript was amplified with the nearly universal primers TAReuk454FWD1 (5′-CCAGCASCYGCGGTAATTCC-3′) and TAReukREV3 (5′-ACTTTCGTTCTTGATYRA-3′) (Stoek et al., 2010). Primers were adapted for 454 sequencing by addition of FLX Titanium adapters (A adapter sequence: 5′ CCATCTCATCCCTGCGTGTCTCCGACTCAG 3′; B adapter sequence: 5′ CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3′) and incorporation of 10bp multiplex identifier (MID) barcodes to facilitate multiplexing.</p>
<p>Life Technologies AccuPrime PCR system was used to amplify the DNA. 1 µl of each sample (35-100 ng) was used in a 20 µl PCR reaction, which contained 1X AccuPrime Buffer II, .75 units of AccuPrime Taq High Fidelity, and a final primer concentration of 200 nM. A no template negative control for cDNA synthesis was used as a negative control for subsequent PCRs reactions. Cycling conditions included an initial denaturation at 95°C for 2 minutes, 30 cycles of 95°C for 20 seconds, 56°C for 30&nbsp;seconds, 72°C for 5 minutes using a Life Technologies ProFlex PCR system. 2 µl of the samples and 5 µL of the negative control were run on a 1% agarose gel at 105 V for 35 minutes. Reactions were cleaned using Ampure XP beads&nbsp;(Beckman Coulter, Brea CA). The final products were resuspended in 25 µL of Qiagen elution buffer and 2.5 µL was uses for visualization on an agarose gel. 1 µL was used to quantify the final product using LifeTechnologies’&nbsp;PicoGreen Quant-IT assay. 20 ng and 30 ng of each 16S or 18S amplicon respectively were pooled&nbsp;separately for sequencing. &nbsp;</p>
<p>Library QC, emPCR, enrichment and 454 sequencing were performed by following the vendor’s standard protocols (Roche Diagnostics) with some modifications.&nbsp; Specifically, qPCR was used to accurately estimate the number of molecules needed for emPCR using KAPA Biosystems Library Quantification Kit. Automation (BioMek FX) was used to “break” the emulsions after emPCR and butanol was used to enable easier sample handling during the breaking process. The REM e (Robotic Enrichment Module) from Roche was used to automate the bead enrichment process in the pipeline. Generally, between 10,000 and 40,000 16S and 18S sequences were recovered and analyzed for each of the samples.] &nbsp;</p>
<p><strong>References:</strong></p>
<p>Herlemann D P R, Labrenz M, Jürgens K, Bertilsson S, Waniek J J, Andersson A F (2011) Transitions in bacterial communities along the 2000 km salinity gradient of the Baltic Sea. The ISME J&nbsp; 5: 1571-1579</p>
<p>Lane D J, Pace B, Olsen G J, Stahl D A, Sogin M&nbsp; L, Pace N R (1985) Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc of the Nat Acad of Sci USA. &nbsp;82: 6955-6959</p>
<p>Stoeck T, Bass D, Nebel M, Christen, R, Jones M D M, Breiner H W, Richards T A. (2010). Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Molecular Ecology 19: 21-31.</p>
<p>Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, Yooseph S et al (2007). The Sorcerer II global ocean sampling expedition: Northwest Atlantic through Eastern Tropical Pacific. PloS Biology 5: 398-431.</p>
Specified by the Principal Investigator(s)
<p>Taxonomic annotation was performed via BLAST search against the SILVA database (Quast et al., 2013)</p>
<p>Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glockner F O (2013) The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res 41: D590-6&nbsp;</p>
<p><strong>BCO-DMO Processing:</strong></p>
<p>- added conventional header with dataset name, PI name, version date<br />
- renamed parameters to BCO-DMO standard</p>
Specified by the Principal Investigator(s)
asNeeded
7.x-1.1
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
PI Supplied Instrument Name: Instrument Name: CTD - profiler Instrument Short Name: Instrument Description: The Conductivity, Temperature, Depth (CTD) unit is an integrated instrument package designed to measure the conductivity, temperature, and pressure (depth) of the water column. The instrument is lowered via cable through the water column. It permits scientists to observe the physical properties in real-time via a conducting cable, which is typically connected to a CTD to a deck unit and computer on a ship. The CTD is often configured with additional optional sensors including fluorometers, transmissometers and/or radiometers. It is often combined with a Rosette of water sampling bottles (e.g. Niskin, GO-FLO) for collecting discrete water samples during the cast.
This term applies to profiling CTDs. For fixed CTDs, see https://www.bco-dmo.org/instrument/869934. Community Standard Description: http://vocab.nerc.ac.uk/collection/L05/current/130/
PI Supplied Instrument Name: Instrument Name: Fluorometer Instrument Short Name:Fluorometer Instrument Description: A fluorometer or fluorimeter is a device used to measure parameters of fluorescence: its intensity and wavelength distribution of emission spectrum after excitation by a certain spectrum of light. The instrument is designed to measure the amount of stimulated electromagnetic radiation produced by pulses of electromagnetic radiation emitted into a water sample or in situ. Community Standard Description: http://vocab.nerc.ac.uk/collection/L05/current/113/
PI Supplied Instrument Name: Instrument Name: Niskin bottle Instrument Short Name:Niskin bottle Instrument Description: A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc. Community Standard Description: http://vocab.nerc.ac.uk/collection/L22/current/TOOL0412/
PI Supplied Instrument Name: PI Supplied Instrument Description:Life Technologies AccuPrime PCR system Instrument Name: Thermal Cycler Instrument Short Name:Thermal Cycler Instrument Description: A thermal cycler or "thermocycler" is a general term for a type of laboratory apparatus, commonly used for performing polymerase chain reaction (PCR), that is capable of repeatedly altering and maintaining specific temperatures for defined periods of time. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. They can also be used to facilitate other temperature-sensitive reactions, including restriction enzyme digestion or rapid diagnostics.
(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)
Cruise: AE1203
AE1203
R/V Atlantic Explorer
Community Standard Description
International Council for the Exploration of the Sea
R/V Atlantic Explorer
vessel
AE1203
Bess B. Ward
Princeton University
Cruise: AE1220
AE1220
R/V Atlantic Explorer
Community Standard Description
International Council for the Exploration of the Sea
R/V Atlantic Explorer
vessel
AE1220
Bess B. Ward
Princeton University
R/V Atlantic Explorer
Community Standard Description
International Council for the Exploration of the Sea
R/V Atlantic Explorer
vessel