Table of Contents

• Coverage
• Dataset Description
  • Methods & Sampling
  • Data Processing Description
• Data Files
• Parameters
• Instruments
• Deployments
• Project Information
• Program Information
• Funding

Quantitative PCR data from sediment samples

Locations:
Site 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C (Bornholm Basin).
Subsurface samples as deep as 85 meters below the Baltic Sea floor.

Sampling and Analytical Methodology:
Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

Primers Used:

Primer name     Sequence (5' - 3')           Target          Reference
Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002
Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002
Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012
Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012
ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011
ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011
MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012
MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012

Primers used from the following publications:
Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments

Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set

Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea

Data Processing:
Absolute quantification was calculated by converting Ct values of samples into copy numbers per
microliter of DNA with the linear equation produced by the standard curve with R2 greater than 0.95.
The quantification limit was defined as having fluorescence threshold cycle numbers (Ct) well within
those of the simultaneously-run standard curve and being at least 3 Ct below the non-template control
Ct.

BCO-DMO Processing Notes
- Generated from original file "qPCR Exp IODP 347.xlsx, sheet: qPCR" contributed by Joy Buongiorno
- Parameter names edited to conform to BCO-DMO naming convention found at Choosing Parameter Name
- Latitude and Longitude for sample inserted from Sites data
- "nd" (no data) inserted into blank cells

Marine sediments contain a microbial population large enough to rival that of Earth's oceans, but much about this vast community is unknown. Innovations in total cell counting methods have refined estimates of cell concentrations, but tell us nothing about specific taxa. Isotopic data provides evidence that a majority of subsurface microorganisms survive by breaking down organic matter, yet measurable links between specific microbial taxa and their organic matter substrates are untested. The proposed work overcomes these limitations, with a particular focus on the degradation of proteins and carbohydrates, which comprise the bulk of classifiable sedimentary organic matter. The project will link specific taxa to potential extracellular enzyme activity in the genomes of single microbial cells, apply newly-identified, optimal methods for counting viable cells belonging to specific taxa using catalyzed reporter deposition fluorescent in situ hybridization (CARD-FISH), and measure the potential activity of their enzymes in situ. The resulting data will provide key evidence about the strategies subsurface life uses to overcome extreme energy limitation and contribute to the long-term carbon cycle.

The Principal Investigators are employing novel,improved methods to quantify cells of specific taxa in the marine subsurface and to determine the biogeochemical functions of those uncultured taxa, including:
1) Determine the pathway of organic carbon degradation in single cell genomes of uncultured, numerically dominant subsurface microorganisms.
2) Quantify viable bacteria and archaea in the deep subsurface using an improvement on the existing technology of CARD-FISH.
3 )Measure the potential activities (Vmax values) of enzymes in deep Baltic Sea sediments, and use the abundances of enzyme-producing microorganisms to calculate depth profiles of cell-specific Vmax values.

The project combines these methods in order to identify and quantify the cells capable of degrading organic matter in deep sediments of the Baltic Sea, obtained from Integrated Ocean Drilling Program (IODP) expedition 347. These results will greatly expand our knowledge of the function and activity of uncultured microorganisms in the deep subsurface.

This project is associated with C-DEBI account number 157595.

The International Ocean Discovery Program (IODP) is an international marine research collaboration that explores Earth's history and dynamics using ocean-going research platforms to recover data recorded in seafloor sediments and rocks and to monitor subseafloor environments. IODP depends on facilities funded by three platform providers with financial contributions from five additional partner agencies. Together, these entities represent 26 nations whose scientists are selected to staff IODP research expeditions conducted throughout the world's oceans.

IODP expeditions are developed from hypothesis-driven science proposals aligned with the program's science plan Illuminating Earth's Past, Present, and Future. The science plan identifies 14 challenge questions in the four areas of climate change, deep life, planetary dynamics, and geohazards. 

IODP's three platform providers include:

• The U.S. National Science Foundation (NSF) 
• Japan's Ministry of Education, Culture, Sports, Science and Technology (MEXT) 
• The European Consortium for Ocean Research Drilling (ECORD)

More information on IODP, including the Science Plan and Policies/Procedures, can be found on their website at http://www.iodp.org/program-documents.

The mission of the Center for Dark Energy Biosphere Investigations (C-DEBI) is to explore life beneath the seafloor and make transformative discoveries that advance science, benefit society, and inspire people of all ages and origins.

C-DEBI provides a framework for a large, multi-disciplinary group of scientists to pursue fundamental questions about life deep in the sub-surface environment of Earth. The fundamental science questions of C-DEBI involve exploration and discovery, uncovering the processes that constrain the sub-surface biosphere below the oceans, and implications to the Earth system. What type of life exists in this deep biosphere, how much, and how is it distributed and dispersed? What are the physical-chemical conditions that promote or limit life? What are the important oxidation-reduction processes and are they unique or important to humankind? How does this biosphere influence global energy and material cycles, particularly the carbon cycle? Finally, can we discern how such life evolved in geological settings beneath the ocean floor, and how this might relate to ideas about the origin of life on our planet?

C-DEBI's scientific goals are pursued with a combination of approaches:
(1) coordinate, integrate, support, and extend the research associated with four major programs—Juan de Fuca Ridge flank (JdF), South Pacific Gyre (SPG), North Pond (NP), and Dorado Outcrop (DO)—and other field sites;
(2) make substantial investments of resources to support field, laboratory, analytical, and modeling studies of the deep subseafloor ecosystems;
(3) facilitate and encourage synthesis and thematic understanding of submarine microbiological processes, through funding of scientific and technical activities, coordination and hosting of meetings and workshops, and support of (mostly junior) researchers and graduate students; and
(4) entrain, educate, inspire, and mentor an interdisciplinary community of researchers and educators, with an emphasis on undergraduate and graduate students and early-career scientists.

Note: Katrina Edwards was a former PI of C-DEBI; James Cowen is a former co-PI.

Data Management:
C-DEBI is committed to ensuring all the data generated are publically available and deposited in a data repository for long-term storage as stated in their Data Management Plan (PDF) and in compliance with the NSF Ocean Sciences Sample and Data Policy. The data types and products resulting from C-DEBI-supported research include a wide variety of geophysical, geological, geochemical, and biological information, in addition to education and outreach materials, technical documents, and samples. All data and information generated by C-DEBI-supported research projects are required to be made publically available either following publication of research results or within two (2) years of data generation.

To ensure preservation and dissemination of the diverse data-types generated, C-DEBI researchers are working with BCO-DMO Data Managers make data publicly available online. The partnership with BCO-DMO helps ensure that the C-DEBI data are discoverable and available for reuse. Some C-DEBI data is better served by specialized repositories (NCBI's GenBank for sequence data, for example) and, in those cases, BCO-DMO provides dataset documentation (metadata) that includes links to those external repositories.