Table of Contents

• Coverage
• Dataset Description
  • Methods & Sampling
  • Data Processing Description
• Data Files
• Related Publications
• Related Datasets
• Parameters
• Instruments
• Deployments
• Project Information
• Funding

This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI. These are described below and cited under "Related Datasets".

Surface water samples were collected at approximately 2m depth using a Niskin bottle or a bucket near the Martha’s Vineyard Coastal Observatory (MVCO) offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from February 2013 – August 2017 about every 1-2 months, and usually twice monthly April – November, for a total of 62 samples. Water was kept cool and in the dark for transport back to the laboratory (about 1.5 hours). 

Environmental data:
Reported temperature data are from the CTD rosette aboard the R/V Tioga. Chlorophyll and phaeo were collected and analyzed in the Sosik lab at WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90% acetone.

Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol summary can be found in the NES-LTER EDI data submission: https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-nes.1.2

HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary protocol for HPLC and chl is available from Seabass: https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents

Sequencing data:
Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto 45mm 0.22 µm Durapore GV filters under gentle vacuum. Filters were cut in half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until extraction.

Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA MicroPrep Kit (Zymo Research Products). One half filter for each sample was transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer, and then shaken using a vortex adapter for 5 minutes. The extraction was then processed following the kit instructions and the eluted DNA frozen at -20C.

The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and sequencing using 574V4F (5' [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5' [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq (in square brackets). PCR reactions were accomplished in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq GoldR 360 DNA polymerase, 2mM MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95C for 8 minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90 seconds; 72C for 5 minutes; 4C hold. No template negative controls were included with every set of PCRs. Each sample reaction was examined to confirm the correct product size of approximately 500 bp. Triplicate reactions were pooled and purified using either DNA Clean and Concentrator – 5 kit (Zymo Research) or AMPure XP beads. The samples were sent to the University of Rhode Island Genomics and Sequencing Center for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62 were sequenced in separate runs about a year apart.

Ciliate-specific amplicons were generated by amplifying the region between 152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for amplification, and triplicate reactions were accomplished for each sample. Replicates were combined and purified using Agencourt AMPure XP. Products were sent to URI Genomics and Sequencing Center for Illumina MiSeq.

V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging FlowCytobot Dashboard for shared access to image data and data products, including MVCO time series, is available at https://ifcb-data.whoi.edu/mvco and the WHOI dock time series is available at https://ifcb-data.whoi.edu/WHOI_dock.

BCO-DMO Processing:
- renamed fields;
- converted date to YYYY-MM-DD format;
- changed missing data identifiers from "NaN" to "nd".

Description from NSF award abstract:
Some of the most important primary producers and consumers in aquatic ecosystems are protists, or single-celled eukaryotes. It is well established that protistan predation can be a significant source of mortality for bacteria and phytoplankton. Grazing protists in turn serve as prey for zooplankton (copepods), and through the excretion of nitrogen and phosphorus compounds, they play a major role in the release of regenerated nutrients. Despite decades of studies on protistan grazing, knowledge gaps still exist with respect to their abundance, distribution, seasonality, prey selectivity, and co-occurrence patterns. The results from this project will advance the understanding of grazing communities in situ and how they respond to environmental conditions and prey communities. This will be one of very few studies of grazers that is unbiased by artificial prey and containment, and will yield both morphologic and genetic information about the organisms present and the distribution patterns of particular grazer populations.

This project examines whether the persistence of a group of protistan grazers is determined by its feeding strategy (grazers with specialist feeding strategies are more ephemeral than generalists), and whether certain morphotypes exhibiting generalist feeding strategies have underlying genotypic diversity that maps to specialist feeding strategies. It builds upon an ongoing time series (with hourly resolution since 2006) of automated, high-resolution, measurements of the phytoplankton community by the Imaging FlowCytobot at the Martha's Vineyard Coastal Observatory. These measurements have led to the observation that, in addition to shifts from pico- and small nanoplankton during the summer to larger microplankton in the fall and winter, particular species (especially among the diatoms) exhibit distinct and recurring seasonal patterns. The instrument will be modified to also conduct automated measurements of grazer communities in situ. Links between selected grazer taxa (chosen based on the image time series) and phytoplankton prey will be provided through genetic analyses of individual cells (with their ingested prey). These cells will be obtained by use of a recently developed cell sorter that also captures an image of each sorted cell. In addition to providing predator/prey links, the genetic information will allow the investigators to determine whether a grazer morphotype represents multiple species. A third approach, high throughput sequencing and quantitative PCR analysis of whole water samples, will be applied to investigate abundance patterns of species whose morphology does not reliably map to genotype.