http://lod.bco-dmo.org/id/dataset/847495 eng; USA utf8 dataset Highest level of data collection, from a common set of sensors or instrumentation, usually within the same research project Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact 2021-04-05 ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data ISO 19115-2:2009(E) Presence or absence of amplicon sequence variants (ASVs) recovered from samples which are described in DATASET 01, Pseudo-nitzschia spp. from weekly samples and offshore cruises with the Northeast U.S. Shelf (NES) Long-Term Ecological Research (LTER) 2021-04-05 publication 2021-04-05 revision Marine Biological Laboratory/Woods Hole Oceanographic Institution Library (MBLWHOI DLA) 2021-04-29 publication https://doi.org/10.26008/1912/bco-dmo.847495.1 Bethany D. Jenkins University of Rhode Island principalInvestigator Matthew Bertin University of Rhode Island principalInvestigator Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. publisher Cite this dataset as: Jenkins, B. D., Bertin, M. (2021) Presence or absence of amplicon sequence variants (ASVs) recovered from samples which are described in DATASET 01, Pseudo-nitzschia spp. from weekly samples and offshore cruises with the Northeast U.S. Shelf (NES) Long-Term Ecological Research (LTER). Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2021-04-05 [if applicable, indicate subset used]. doi:10.26008/1912/bco-dmo.847495.1 [access date] Pseudo-nitzschia asv Dataset Description: Methods and Sampling: &lt;p&gt;For most samples, plankton biomass for Pseudo-nitzschia DNA identification was collected by passing an average of 270 mL of surface seawater with a peristaltic pump across a 25 mm 5.0 mm polyester membrane filter (Sterlitech, Kent, WA, USA). Widths of some Pseudo-nitzschia spp. are &amp;lt; 5.0 mm (Lelong et al. 2012), but this size pore likely captured horizontally orientated cells and chains of cells, and was consistent with pore size used to examine toxicity. Filters were flash frozen in liquid nitrogen and stored at -80 °C until extraction. DNA was extracted using a modified version of the DNeasy Plant DNA extraction kit (Qiagen, Germantown, MD, USA) with an added bead beating step for 1 minute and QIA-Shredder column (Qiagen, Germantown, MD, USA) as reported in Chappell et al. 2019. Additionally, DNA was eluted in 30 µL with a second elution step of either 30 or 15 µL to maximize DNA yield. DNA was assessed for quality with a Nanodrop spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) and quantified using a Qubit fluorometer (Invitrogen, Carlsbad, CA, USA) with the Broad Range dsDNA and High Sensitivity dsDNA kits (Thermo Fisher Scientific Inc., Waltham, MA, USA). DNA yields reported by the Qubit ranged from below the limit of detection to 26.5, with an average of 2.0 ng DNA / mL eluent. Long-Term Plankton Time Series (LTPTS) samples from October 2016 and March 2017 had an average of 300 mL surface seawater passed over a 25 mm 0.2 mm filter, were extracted following existing LTPTS methods of DNA extraction using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA) with an added bead beating step (Canesi and Rynearson 2016), and yielded average 0.9 ng DNA / mL eluent as measured by the Qubit. Net tow samples had 50 mL of concentrate was passed across a 0.22 µm pore size Sterivex filter unit (MilliporeSigma, Burlington, MA, USA), and were extracted with the same modified DNeasy Plant DNA extraction protocol as above, with 4x volumes of AP1 buffer and RNase A and beads added to the unit to account for the larger sample surface area, extraction occurring within the capped unit itself to maximize yield, and then the lysate removed with a sterile syringe and subsequent steps with adjusted volumes as appropriate. As expected, DNA yields were higher from the Sterivex units ranging from 2.4 – 54.0 ng DNA / mL eluent with an average of 13.7 ng DNA/ mL elution as measured by the Qubit. For the March 13, 2017 NBay samples, 125 mL of surface seawater was passed across a HV filter and extracted with the DNeasy Plant DNA extraction kit with scissors and no beads. As measured by the Qubit, the average DNA yield was 3.7 ng DNA / mL eluent. A negative control sample was prepared of a blank 25 mm 5.0 mm polyester membrane filter using extraction reagents which had no detectable DNA using the Qubit. There were two positive controls of mock communities comprised of two known Pseudo-nitzschia species from monocultures. The two Pseudo-nitzschia cultures were P. subcurvata collected from the Southern Ocean and P. pungens isolated from NBay (provided by J. Rines). One positive control was made by combining equal concentrations of extracted DNA with 1.0 ng DNA of each culture. The second positive control was created of equal cell abundance estimated to be captured onto the filters of the cultures prior to extraction. These negative and positive controls were prepared for sequencing and sequenced on the same plate as the other environmental samples.&lt;/p&gt; &lt;p&gt;&lt;br /&gt; The ITS1 has been targeted for amplification and analysis by ARISA previously for Pseudo-nitzschia identification in environmental samples (Hubbard, Rocap, and Armbrust 2008). A comparison of ITS1 appears to be much less conserved and is divergent enough across Pseudo-nitzschia that 41 different species can be identified using existing public sequencing data. The primers to target the ITS1 region of Pseudo-nitzschia used this existing forward primer sequence of the ITS1 region for eukaryotes: TCCGTAGGTGAACCTGCGG (White et al. 1990) and a custom reverse primer designed using 132 Pseudo-nitzschia ITS1 sequences from the NCBI nucleotide database (downloaded on 4/3/2019) from this nucleotide search: ((Pseudo-nitzschia[Organism]) AND internal transcribed spacer[Title]) NOT uncultured): CATCCACCGCTGAAAGTTGTAA. This reverse primer targets a conserved region in the 5.8S. All primer sequences are reported from 5’ – 3’. MiSeq adapter sequences were added to the beginning of the primer sequences for these full sequences used in this study: forward primer TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCGTAGGTGAACCTGCGG and reverse primer GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATCCACCGCTGAAAGTTGTAA. When checking the specificity of these primers using the NCBI nt database, it became known that sequences beyond Pseudo-nitzschia would also be amplified in this study including other diatoms and dinoflagellates; however, the large number of sequencing reads recovered on the MiSeq platform would circumvent this non-specific characteristic of the primers.&lt;/p&gt; &lt;p&gt;The accession numbers of the sequences used in this primer design are reported in Table S2 of Sterling et al. (in prep), along with a summary of Pseudo-nitzschia species expected to amplify with these based on the in silico design. The expected ranges for PCR products were from 235 – 370 bp as the size of the ITS1 region differs for some Pseudo-nitzschia taxa. Primers (Integrated DNA Technologies, Coralville, IA, USA) were HPLC purified, resuspended in 1x Tris-Acetate-EDTA (TAE) buffer, and then working stocks created in diethylpyrocarbonate (DEPC)-treated H2O. About 4 ng of extracted DNA was used for each PCR reaction. If, according to the Qubit quantification, the DNA concentration was less than 2 ng mL-1 or below the limit of detection, it was then used as is, and just 2 mL was added to the PCR reaction. PCR reactions were set up on ice, in a 1x reaction in 25 mL total volume. Final primer concentration was 0.5 mM and polymerase was Phusion Hot Start High-Fidelity Master Mix (Thermo Fisher Scientific Inc., Waltham, MA, USA). There were two cycles with different annealing temperatures, the first with an annealing temperature specific to the loci-specific region and the second set of cycles with an annealing temperature that also takes the MiSeq adapter sequence into account (Canesi and Rynearson 2016). PCR conditions used were initial denaturation for 30 seconds at 98 °C, 15 cycles of the following: denaturation for 10 seconds at 98 °C, annealing for 30 seconds at 64.1 °C , extension for 30 seconds at 72 °C, and 15 cycles with the same conditions except a higher annealing temperature of 72 °C , and then a final extension for 10 minutes at 72 °C , and a holding temperature of 10 °C until stored in the -20 °C freezer. PCR products were visualized on a 1% agarose gel before submission to the URI Genomics and Sequencing Center (Kington, RI, USA) where library preparation and sequencing were performed on a 2x300 bp MiSeq run (Illumina, Inc., San Diego, CA, USA). There were 193 environmental samples were sequenced, along with two positive controls of Pseudo-nitzschia DNA from cultures and one negative control, for a total of 196 samples using two sets of MiSeq indices on the same sequencing plate. It was deemed appropriate to multiplex this plate as estimated read depth to recover Pseudo-nitzschia sequences was predicted to be lower than usual.&lt;/p&gt; &lt;p&gt;The columns are the library_ID as described in DATASET 01: the identifying sample number that connects the row of environmental data to the corresponding plankton biomass filter that was sequenced for the Pseudo-nitzschia species assemblages. The Sequence Sample ID connect to the sample_title, library_ID and file names in NCBI’s Short Read Archive (SRA) under this related Bioproject #PRJNA690940.&lt;/p&gt; &lt;p&gt;The rows are the Sequence_of_ASV as described in DATASET 02: the DNA sequence of the internal transcribed spacer (ITS) 1 region used to identify the Pseudo-nitzschia [NCBI:txid41953] species. Only ASVs shown pass the threshold of accounting for &amp;gt; 1% relative abundance in a sample.&lt;/p&gt; &lt;p&gt;The matrix is filled in indicating whether or not that specific ASV sequence was present in that corresponding sample with 1 = Present and 0 = Absent.&lt;/p&gt; &lt;p&gt;Problem report:&amp;nbsp;Sample #AS424 had no ASVs belonging to &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;sp. and was removed.&lt;/p&gt; Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1655686 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=1655686 Funding provided by NSF Office of Integrative Activities (NSF OIA) Award Number: OIA-1655221 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=1655221 Funding provided by National Oceanic and Atmospheric Administration (NOAA) Award Number: NA18OAR4170094 Funding provided by National Oceanic and Atmospheric Administration (NOAA) Award Number: NA14OAR4170082 completed Bethany D. Jenkins University of Rhode Island 401-874-7551 Department of Cell and Molecular Biology and Graduate School of Oceanography 279 CBLS, 120 Flagg Road Kingston RI 02881 USA bdjenkins@uri.edu pointOfContact Matthew Bertin University of Rhode Island 401 874 5016 mbertin@uri.edu pointOfContact asNeeded Dataset Version: 1 Unknown ASV_sequence AS301 AS302 AS303 AS304 AS305 AS306 AS307 AS308 AS309 AS310 AS311 AS312 AS313 AS314 AS315 AS316 AS317 AS318 AS319 AS320 AS321 AS322 AS323 AS324 AS325 AS326 AS327 AS328 AS329 AS330 AS331 AS332 AS333 AS334 AS335 AS336 AS337 AS338 AS339 AS340 AS341 AS342 AS343 AS344 AS345 AS346 AS347 AS348 AS349 AS350 AS351 AS352 AS353 AS354 AS355 AS356 AS357 AS358 AS359 AS360 AS361 AS362 AS363 AS364 AS365 AS366 AS367 AS368 AS369 AS370 AS371 AS372 AS373 AS374 AS375 AS376 AS377 AS378 AS379 AS380 AS381 AS382 AS383 AS384 AS385 AS386 AS387 AS388 AS389 AS390 AS391 AS392 AS393 AS394 AS395 AS396 AS397 AS398 AS399 AS400 AS401 AS402 AS403 AS404 AS405 AS406 AS407 AS408 AS409 AS410 AS411 AS412 AS413 AS414 AS415 AS416 AS417 AS418 AS419 AS420 AS421 AS422 AS423 AS425 AS426 AS427 AS428 AS429 AS430 AS431 AS432 AS433 AS434 AS435 AS436 AS437 AS438 AS439 AS440 AS441 AS442 AS443 AS444 AS445 AS446 AS447 AS448 AS449 AS450 AS451 AS452 AS453 AS454 AS455 AS456 AS457 AS458 AS459 AS460 AS461 AS462 AS463 AS464 AS465 AS466 AS467 AS468 AS469 AS470 AS471 AS472 AS473 AS474 AS475 AS476 AS477 AS478 AS479 AS480 AS481 AS482 AS483 AS484 AS485 AS486 AS487 AS488 AS489 AS493 AS494 AS495 AS496 Illumina MiSeq Next Generation Sequencing (University of Rhode Island Genomics and Sequencing Center) theme None, User defined sample identification flag featureType BCO-DMO Standard Parameters Automated DNA Sequencer instrument BCO-DMO Standard Instruments EN608 EN617 EN627 EN644 service Deployment Activity Narragansett Bay in Rhode Island, USA and offshore Atlantic Ocean transect across the Northeast U.S. Shelf (NES) place Locations otherRestrictions otherRestrictions Access Constraints: none. Use Constraints: Please follow guidelines at: http://www.bco-dmo.org/terms-use Distribution liability: Under no circumstances shall BCO-DMO be liable for any direct, incidental, special, consequential, indirect, or punitive damages that result from the use of, or the inability to use, the materials in this data submission. If you are dissatisfied with any materials in this data submission your sole and exclusive remedy is to discontinue use. RII Track-1: Rhode Island Consortium for Coastal Ecology Assessment, Innovation, and Modeling https://osprey.bco-dmo.org/project/836631 RII Track-1: Rhode Island Consortium for Coastal Ecology Assessment, Innovation, and Modeling <p>NSF Award Abstract:</p> <p>Non-technical Description<br /> The University of Rhode Island (URI) will establish the Consortium for Coastal Ecology Assessment, Innovation, and Modeling (C-AIM) to coordinate research, education, and workforce development across Rhode Island (RI) in coastal marine science and ecology. C-AIM addresses fundamental research questions using observations, computational methods, and technology development applied to Narraganset Bay (NB), the largest estuary in New England and home to important ecosystem services including fisheries, recreation, and tourism. The research will improve understanding of the microorganisms in NB, develop new models to predict pollution and harmful algal bloom events in NB, build new sensors for nutrients and pollutants, and provide data and tools for stakeholders in the state. Observational capabilities will be coordinated in an open platform for researchers across RI; it will provide real-time physical, chemical, and biological observations ? including live streaming to mobile devices. C-AIM will also establish the RI STEAM (STEM + Art) Imaging Consortium to foster collaboration between artists, designers, engineers, and scientists. Research internships will be offered to undergraduate students throughout the state and seed funding for research projects will be competitively awarded to Primarily Undergraduate Institution partners.</p> <p>Technical Description<br /> C-AIM will employ observations and modeling to assess interactions between organisms and ecosystem function in NB and investigate ecological responses to environmental events, such as hypoxia and algal blooms. Observations of the circulation, biogeochemistry, and ecosystem will be made using existing and new instrument platforms. The Bay Observatory ? a network of observational platforms around NB - will be networked to trigger enhanced water sampling and sensing during specific environmental events, such as hypoxic conditions or phytoplankton blooms. Biogeochemical, ecological, and coastal circulation models will be integrated and coupled to focus on eutrophication and pollutant loading. Data and models will be integrated on multiple scales, from individual organisms and trophic interactions to food-web responses, and from turbulence to the regional ocean circulation. New sensing technologies for nutrients and pollutants will be developed, including affordable, micro-fluidic (Lab-on-a-Chip) devices with antifouling capabilities. The results will be synthesized and communicated to stakeholders.</p> C-AIM largerWorkCitation project eng; USA biota oceans Narragansett Bay in Rhode Island, USA and offshore Atlantic Ocean transect across the Northeast U.S. Shelf (NES) -71.42 -70.8626 40.206 41.6716 2016-09-26 2019-11-25 Narragansett Bay, Rhode Island 0 BCO-DMO catalogue of parameters from Presence or absence of amplicon sequence variants (ASVs) recovered from samples which are described in DATASET 01, Pseudo-nitzschia spp. from weekly samples and offshore cruises with the Northeast U.S. Shelf (NES) Long-Term Ecological Research (LTER) Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact http://lod.bco-dmo.org/id/dataset-parameter/848068.rdf Name: ASV_sequence Units: unitless Description: <p>DNA sequence of the amplicon sequence variants (ASVs)</p> http://lod.bco-dmo.org/id/dataset-parameter/848069.rdf Name: AS301 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS301</p> http://lod.bco-dmo.org/id/dataset-parameter/848070.rdf Name: AS302 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS302</p> http://lod.bco-dmo.org/id/dataset-parameter/848071.rdf Name: AS303 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS303</p> http://lod.bco-dmo.org/id/dataset-parameter/848072.rdf Name: AS304 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS304</p> http://lod.bco-dmo.org/id/dataset-parameter/848073.rdf Name: AS305 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS305</p> http://lod.bco-dmo.org/id/dataset-parameter/848074.rdf Name: AS306 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS306</p> http://lod.bco-dmo.org/id/dataset-parameter/848075.rdf Name: AS307 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS307</p> http://lod.bco-dmo.org/id/dataset-parameter/848076.rdf Name: AS308 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS308</p> http://lod.bco-dmo.org/id/dataset-parameter/848077.rdf Name: AS309 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS309</p> http://lod.bco-dmo.org/id/dataset-parameter/848078.rdf Name: AS310 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS310</p> http://lod.bco-dmo.org/id/dataset-parameter/848079.rdf Name: AS311 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS311</p> http://lod.bco-dmo.org/id/dataset-parameter/848080.rdf Name: AS312 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS312</p> http://lod.bco-dmo.org/id/dataset-parameter/848081.rdf Name: AS313 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS313</p> http://lod.bco-dmo.org/id/dataset-parameter/848082.rdf Name: AS314 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS314</p> http://lod.bco-dmo.org/id/dataset-parameter/848083.rdf Name: AS315 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS315</p> http://lod.bco-dmo.org/id/dataset-parameter/848084.rdf Name: AS316 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS316</p> http://lod.bco-dmo.org/id/dataset-parameter/848085.rdf Name: AS317 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS317</p> http://lod.bco-dmo.org/id/dataset-parameter/848086.rdf Name: AS318 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS318</p> http://lod.bco-dmo.org/id/dataset-parameter/848087.rdf Name: AS319 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS319</p> http://lod.bco-dmo.org/id/dataset-parameter/848088.rdf Name: AS320 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS320</p> http://lod.bco-dmo.org/id/dataset-parameter/848089.rdf Name: AS321 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS321</p> http://lod.bco-dmo.org/id/dataset-parameter/848090.rdf Name: AS322 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS322</p> http://lod.bco-dmo.org/id/dataset-parameter/848091.rdf Name: AS323 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS323</p> http://lod.bco-dmo.org/id/dataset-parameter/848092.rdf Name: AS324 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS324</p> http://lod.bco-dmo.org/id/dataset-parameter/848093.rdf Name: AS325 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS325</p> http://lod.bco-dmo.org/id/dataset-parameter/848094.rdf Name: AS326 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS326</p> http://lod.bco-dmo.org/id/dataset-parameter/848095.rdf Name: AS327 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS327</p> http://lod.bco-dmo.org/id/dataset-parameter/848096.rdf Name: AS328 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS328</p> http://lod.bco-dmo.org/id/dataset-parameter/848097.rdf Name: AS329 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS329</p> http://lod.bco-dmo.org/id/dataset-parameter/848098.rdf Name: AS330 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS330</p> http://lod.bco-dmo.org/id/dataset-parameter/848099.rdf Name: AS331 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS331</p> http://lod.bco-dmo.org/id/dataset-parameter/848100.rdf Name: AS332 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS332</p> http://lod.bco-dmo.org/id/dataset-parameter/848101.rdf Name: AS333 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS333</p> http://lod.bco-dmo.org/id/dataset-parameter/848102.rdf Name: AS334 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS334</p> http://lod.bco-dmo.org/id/dataset-parameter/848103.rdf Name: AS335 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS335</p> http://lod.bco-dmo.org/id/dataset-parameter/848104.rdf Name: AS336 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS336</p> http://lod.bco-dmo.org/id/dataset-parameter/848105.rdf Name: AS337 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS337</p> http://lod.bco-dmo.org/id/dataset-parameter/848106.rdf Name: AS338 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS338</p> http://lod.bco-dmo.org/id/dataset-parameter/848107.rdf Name: AS339 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS339</p> http://lod.bco-dmo.org/id/dataset-parameter/848108.rdf Name: AS340 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS340</p> http://lod.bco-dmo.org/id/dataset-parameter/848109.rdf Name: AS341 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS341</p> http://lod.bco-dmo.org/id/dataset-parameter/848110.rdf Name: AS342 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS342</p> http://lod.bco-dmo.org/id/dataset-parameter/848111.rdf Name: AS343 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS343</p> http://lod.bco-dmo.org/id/dataset-parameter/848112.rdf Name: AS344 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS344</p> http://lod.bco-dmo.org/id/dataset-parameter/848113.rdf Name: AS345 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS345</p> http://lod.bco-dmo.org/id/dataset-parameter/848114.rdf Name: AS346 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS346</p> http://lod.bco-dmo.org/id/dataset-parameter/848115.rdf Name: AS347 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS347</p> http://lod.bco-dmo.org/id/dataset-parameter/848116.rdf Name: AS348 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS348</p> http://lod.bco-dmo.org/id/dataset-parameter/848117.rdf Name: AS349 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS349</p> http://lod.bco-dmo.org/id/dataset-parameter/848118.rdf Name: AS350 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS350</p> http://lod.bco-dmo.org/id/dataset-parameter/848119.rdf Name: AS351 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS351</p> http://lod.bco-dmo.org/id/dataset-parameter/848120.rdf Name: AS352 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS352</p> http://lod.bco-dmo.org/id/dataset-parameter/848121.rdf Name: AS353 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS353</p> http://lod.bco-dmo.org/id/dataset-parameter/848122.rdf Name: AS354 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS354</p> http://lod.bco-dmo.org/id/dataset-parameter/848123.rdf Name: AS355 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS355</p> http://lod.bco-dmo.org/id/dataset-parameter/848124.rdf Name: AS356 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS356</p> http://lod.bco-dmo.org/id/dataset-parameter/848125.rdf Name: AS357 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS357</p> http://lod.bco-dmo.org/id/dataset-parameter/848126.rdf Name: AS358 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS358</p> http://lod.bco-dmo.org/id/dataset-parameter/848127.rdf Name: AS359 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS359</p> http://lod.bco-dmo.org/id/dataset-parameter/848128.rdf Name: AS360 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS360</p> http://lod.bco-dmo.org/id/dataset-parameter/848129.rdf Name: AS361 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS361</p> http://lod.bco-dmo.org/id/dataset-parameter/848130.rdf Name: AS362 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS362</p> http://lod.bco-dmo.org/id/dataset-parameter/848131.rdf Name: AS363 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS363</p> http://lod.bco-dmo.org/id/dataset-parameter/848132.rdf Name: AS364 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS364</p> http://lod.bco-dmo.org/id/dataset-parameter/848133.rdf Name: AS365 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS365</p> http://lod.bco-dmo.org/id/dataset-parameter/848134.rdf Name: AS366 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS366</p> http://lod.bco-dmo.org/id/dataset-parameter/848135.rdf Name: AS367 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS367</p> http://lod.bco-dmo.org/id/dataset-parameter/848136.rdf Name: AS368 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS368</p> http://lod.bco-dmo.org/id/dataset-parameter/848137.rdf Name: AS369 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS369</p> http://lod.bco-dmo.org/id/dataset-parameter/848138.rdf Name: AS370 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS370</p> http://lod.bco-dmo.org/id/dataset-parameter/848139.rdf Name: AS371 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS371</p> http://lod.bco-dmo.org/id/dataset-parameter/848140.rdf Name: AS372 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS372</p> http://lod.bco-dmo.org/id/dataset-parameter/848141.rdf Name: AS373 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS373</p> http://lod.bco-dmo.org/id/dataset-parameter/848142.rdf Name: AS374 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS374</p> http://lod.bco-dmo.org/id/dataset-parameter/848143.rdf Name: AS375 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS375</p> http://lod.bco-dmo.org/id/dataset-parameter/848144.rdf Name: AS376 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS376</p> http://lod.bco-dmo.org/id/dataset-parameter/848145.rdf Name: AS377 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS377</p> http://lod.bco-dmo.org/id/dataset-parameter/848146.rdf Name: AS378 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS378</p> http://lod.bco-dmo.org/id/dataset-parameter/848147.rdf Name: AS379 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS379</p> http://lod.bco-dmo.org/id/dataset-parameter/848148.rdf Name: AS380 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS380</p> http://lod.bco-dmo.org/id/dataset-parameter/848149.rdf Name: AS381 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS381</p> http://lod.bco-dmo.org/id/dataset-parameter/848150.rdf Name: AS382 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS382</p> http://lod.bco-dmo.org/id/dataset-parameter/848151.rdf Name: AS383 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS383</p> http://lod.bco-dmo.org/id/dataset-parameter/848152.rdf Name: AS384 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS384</p> http://lod.bco-dmo.org/id/dataset-parameter/848153.rdf Name: AS385 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS385</p> http://lod.bco-dmo.org/id/dataset-parameter/848154.rdf Name: AS386 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS386</p> http://lod.bco-dmo.org/id/dataset-parameter/848155.rdf Name: AS387 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS387</p> http://lod.bco-dmo.org/id/dataset-parameter/848156.rdf Name: AS388 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS388</p> http://lod.bco-dmo.org/id/dataset-parameter/848157.rdf Name: AS389 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS389</p> http://lod.bco-dmo.org/id/dataset-parameter/848158.rdf Name: AS390 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS390</p> http://lod.bco-dmo.org/id/dataset-parameter/848159.rdf Name: AS391 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS391</p> http://lod.bco-dmo.org/id/dataset-parameter/848160.rdf Name: AS392 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS392</p> http://lod.bco-dmo.org/id/dataset-parameter/848161.rdf Name: AS393 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS393</p> http://lod.bco-dmo.org/id/dataset-parameter/848162.rdf Name: AS394 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS394</p> http://lod.bco-dmo.org/id/dataset-parameter/848163.rdf Name: AS395 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS395</p> http://lod.bco-dmo.org/id/dataset-parameter/848164.rdf Name: AS396 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS396</p> http://lod.bco-dmo.org/id/dataset-parameter/848165.rdf Name: AS397 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS397</p> http://lod.bco-dmo.org/id/dataset-parameter/848166.rdf Name: AS398 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS398</p> http://lod.bco-dmo.org/id/dataset-parameter/848167.rdf Name: AS399 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS399</p> http://lod.bco-dmo.org/id/dataset-parameter/848168.rdf Name: AS400 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS400</p> http://lod.bco-dmo.org/id/dataset-parameter/848169.rdf Name: AS401 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS401</p> http://lod.bco-dmo.org/id/dataset-parameter/848170.rdf Name: AS402 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS402</p> http://lod.bco-dmo.org/id/dataset-parameter/848171.rdf Name: AS403 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS403</p> http://lod.bco-dmo.org/id/dataset-parameter/848172.rdf Name: AS404 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS404</p> http://lod.bco-dmo.org/id/dataset-parameter/848173.rdf Name: AS405 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS405</p> http://lod.bco-dmo.org/id/dataset-parameter/848174.rdf Name: AS406 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS406</p> http://lod.bco-dmo.org/id/dataset-parameter/848175.rdf Name: AS407 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS407</p> http://lod.bco-dmo.org/id/dataset-parameter/848176.rdf Name: AS408 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS408</p> http://lod.bco-dmo.org/id/dataset-parameter/848177.rdf Name: AS409 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS409</p> http://lod.bco-dmo.org/id/dataset-parameter/848178.rdf Name: AS410 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS410</p> http://lod.bco-dmo.org/id/dataset-parameter/848179.rdf Name: AS411 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS411</p> http://lod.bco-dmo.org/id/dataset-parameter/848180.rdf Name: AS412 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS412</p> http://lod.bco-dmo.org/id/dataset-parameter/848181.rdf Name: AS413 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS413</p> http://lod.bco-dmo.org/id/dataset-parameter/848182.rdf Name: AS414 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS414</p> http://lod.bco-dmo.org/id/dataset-parameter/848183.rdf Name: AS415 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS415</p> http://lod.bco-dmo.org/id/dataset-parameter/848184.rdf Name: AS416 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS416</p> http://lod.bco-dmo.org/id/dataset-parameter/848185.rdf Name: AS417 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS417</p> http://lod.bco-dmo.org/id/dataset-parameter/848186.rdf Name: AS418 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS418</p> http://lod.bco-dmo.org/id/dataset-parameter/848187.rdf Name: AS419 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS419</p> http://lod.bco-dmo.org/id/dataset-parameter/848188.rdf Name: AS420 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS420</p> http://lod.bco-dmo.org/id/dataset-parameter/848189.rdf Name: AS421 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS421</p> http://lod.bco-dmo.org/id/dataset-parameter/848190.rdf Name: AS422 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS422</p> http://lod.bco-dmo.org/id/dataset-parameter/848191.rdf Name: AS423 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS423</p> http://lod.bco-dmo.org/id/dataset-parameter/848192.rdf Name: AS425 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS425</p> http://lod.bco-dmo.org/id/dataset-parameter/848193.rdf Name: AS426 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS426</p> http://lod.bco-dmo.org/id/dataset-parameter/848194.rdf Name: AS427 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS427</p> http://lod.bco-dmo.org/id/dataset-parameter/848195.rdf Name: AS428 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS428</p> http://lod.bco-dmo.org/id/dataset-parameter/848196.rdf Name: AS429 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS429</p> http://lod.bco-dmo.org/id/dataset-parameter/848197.rdf Name: AS430 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS430</p> http://lod.bco-dmo.org/id/dataset-parameter/848198.rdf Name: AS431 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS431</p> http://lod.bco-dmo.org/id/dataset-parameter/848199.rdf Name: AS432 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS432</p> http://lod.bco-dmo.org/id/dataset-parameter/848200.rdf Name: AS433 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS433</p> http://lod.bco-dmo.org/id/dataset-parameter/848201.rdf Name: AS434 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS434</p> http://lod.bco-dmo.org/id/dataset-parameter/848202.rdf Name: AS435 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS435</p> http://lod.bco-dmo.org/id/dataset-parameter/848203.rdf Name: AS436 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS436</p> http://lod.bco-dmo.org/id/dataset-parameter/848204.rdf Name: AS437 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS437</p> http://lod.bco-dmo.org/id/dataset-parameter/848205.rdf Name: AS438 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS438</p> http://lod.bco-dmo.org/id/dataset-parameter/848206.rdf Name: AS439 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS439</p> http://lod.bco-dmo.org/id/dataset-parameter/848207.rdf Name: AS440 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS440</p> http://lod.bco-dmo.org/id/dataset-parameter/848208.rdf Name: AS441 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS441</p> http://lod.bco-dmo.org/id/dataset-parameter/848209.rdf Name: AS442 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS442</p> http://lod.bco-dmo.org/id/dataset-parameter/848210.rdf Name: AS443 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS443</p> http://lod.bco-dmo.org/id/dataset-parameter/848211.rdf Name: AS444 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS444</p> http://lod.bco-dmo.org/id/dataset-parameter/848212.rdf Name: AS445 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS445</p> http://lod.bco-dmo.org/id/dataset-parameter/848213.rdf Name: AS446 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS446</p> http://lod.bco-dmo.org/id/dataset-parameter/848214.rdf Name: AS447 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS447</p> http://lod.bco-dmo.org/id/dataset-parameter/848215.rdf Name: AS448 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS448</p> http://lod.bco-dmo.org/id/dataset-parameter/848216.rdf Name: AS449 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS449</p> http://lod.bco-dmo.org/id/dataset-parameter/848217.rdf Name: AS450 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS450</p> http://lod.bco-dmo.org/id/dataset-parameter/848218.rdf Name: AS451 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS451</p> http://lod.bco-dmo.org/id/dataset-parameter/848219.rdf Name: AS452 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS452</p> http://lod.bco-dmo.org/id/dataset-parameter/848220.rdf Name: AS453 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS453</p> http://lod.bco-dmo.org/id/dataset-parameter/848221.rdf Name: AS454 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS454</p> http://lod.bco-dmo.org/id/dataset-parameter/848222.rdf Name: AS455 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS455</p> http://lod.bco-dmo.org/id/dataset-parameter/848223.rdf Name: AS456 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS456</p> http://lod.bco-dmo.org/id/dataset-parameter/848224.rdf Name: AS457 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS457</p> http://lod.bco-dmo.org/id/dataset-parameter/848225.rdf Name: AS458 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS458</p> http://lod.bco-dmo.org/id/dataset-parameter/848226.rdf Name: AS459 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS459</p> http://lod.bco-dmo.org/id/dataset-parameter/848227.rdf Name: AS460 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS460</p> http://lod.bco-dmo.org/id/dataset-parameter/848228.rdf Name: AS461 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS461</p> http://lod.bco-dmo.org/id/dataset-parameter/848229.rdf Name: AS462 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS462</p> http://lod.bco-dmo.org/id/dataset-parameter/848230.rdf Name: AS463 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS463</p> http://lod.bco-dmo.org/id/dataset-parameter/848231.rdf Name: AS464 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS464</p> http://lod.bco-dmo.org/id/dataset-parameter/848232.rdf Name: AS465 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS465</p> http://lod.bco-dmo.org/id/dataset-parameter/848233.rdf Name: AS466 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS466</p> http://lod.bco-dmo.org/id/dataset-parameter/848234.rdf Name: AS467 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS467</p> http://lod.bco-dmo.org/id/dataset-parameter/848235.rdf Name: AS468 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS468</p> http://lod.bco-dmo.org/id/dataset-parameter/848236.rdf Name: AS469 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS469</p> http://lod.bco-dmo.org/id/dataset-parameter/848237.rdf Name: AS470 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS470</p> http://lod.bco-dmo.org/id/dataset-parameter/848238.rdf Name: AS471 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS471</p> http://lod.bco-dmo.org/id/dataset-parameter/848239.rdf Name: AS472 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS472</p> http://lod.bco-dmo.org/id/dataset-parameter/848240.rdf Name: AS473 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS473</p> http://lod.bco-dmo.org/id/dataset-parameter/848241.rdf Name: AS474 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS474</p> http://lod.bco-dmo.org/id/dataset-parameter/848242.rdf Name: AS475 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS475</p> http://lod.bco-dmo.org/id/dataset-parameter/848243.rdf Name: AS476 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS476</p> http://lod.bco-dmo.org/id/dataset-parameter/848244.rdf Name: AS477 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS477</p> http://lod.bco-dmo.org/id/dataset-parameter/848245.rdf Name: AS478 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS478</p> http://lod.bco-dmo.org/id/dataset-parameter/848246.rdf Name: AS479 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS479</p> http://lod.bco-dmo.org/id/dataset-parameter/848247.rdf Name: AS480 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS480</p> http://lod.bco-dmo.org/id/dataset-parameter/848248.rdf Name: AS481 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS481</p> http://lod.bco-dmo.org/id/dataset-parameter/848249.rdf Name: AS482 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS482</p> http://lod.bco-dmo.org/id/dataset-parameter/848250.rdf Name: AS483 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS483</p> http://lod.bco-dmo.org/id/dataset-parameter/848251.rdf Name: AS484 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS484</p> http://lod.bco-dmo.org/id/dataset-parameter/848252.rdf Name: AS485 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS485</p> http://lod.bco-dmo.org/id/dataset-parameter/848253.rdf Name: AS486 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS486</p> http://lod.bco-dmo.org/id/dataset-parameter/848254.rdf Name: AS487 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS487</p> http://lod.bco-dmo.org/id/dataset-parameter/848255.rdf Name: AS488 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS488</p> http://lod.bco-dmo.org/id/dataset-parameter/848256.rdf Name: AS489 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS489</p> http://lod.bco-dmo.org/id/dataset-parameter/848257.rdf Name: AS493 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS493</p> http://lod.bco-dmo.org/id/dataset-parameter/848258.rdf Name: AS494 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS494</p> http://lod.bco-dmo.org/id/dataset-parameter/848259.rdf Name: AS495 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS495</p> http://lod.bco-dmo.org/id/dataset-parameter/848260.rdf Name: AS496 Units: unitless Description: <p>presence (1) or absence (0) of the ASV in sample number AS496</p> GB/NERC/BODC > British Oceanographic Data Centre, Natural Environment Research Council, United Kingdom Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact 36612 https://darchive.mblwhoilibrary.org/bitstream/1912/27031/1/dataset-847495_pseudo-nitzschia-presenceabsence-amplicon-sequence-variants-asvs__v1.tsv download https://doi.org/10.26008/1912/bco-dmo.847495.1 download onLine dataset &lt;p&gt;For most samples, plankton biomass for Pseudo-nitzschia DNA identification was collected by passing an average of 270 mL of surface seawater with a peristaltic pump across a 25 mm 5.0 mm polyester membrane filter (Sterlitech, Kent, WA, USA). Widths of some Pseudo-nitzschia spp. are &amp;lt; 5.0 mm (Lelong et al. 2012), but this size pore likely captured horizontally orientated cells and chains of cells, and was consistent with pore size used to examine toxicity. Filters were flash frozen in liquid nitrogen and stored at -80 °C until extraction. DNA was extracted using a modified version of the DNeasy Plant DNA extraction kit (Qiagen, Germantown, MD, USA) with an added bead beating step for 1 minute and QIA-Shredder column (Qiagen, Germantown, MD, USA) as reported in Chappell et al. 2019. Additionally, DNA was eluted in 30 µL with a second elution step of either 30 or 15 µL to maximize DNA yield. DNA was assessed for quality with a Nanodrop spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) and quantified using a Qubit fluorometer (Invitrogen, Carlsbad, CA, USA) with the Broad Range dsDNA and High Sensitivity dsDNA kits (Thermo Fisher Scientific Inc., Waltham, MA, USA). DNA yields reported by the Qubit ranged from below the limit of detection to 26.5, with an average of 2.0 ng DNA / mL eluent. Long-Term Plankton Time Series (LTPTS) samples from October 2016 and March 2017 had an average of 300 mL surface seawater passed over a 25 mm 0.2 mm filter, were extracted following existing LTPTS methods of DNA extraction using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA) with an added bead beating step (Canesi and Rynearson 2016), and yielded average 0.9 ng DNA / mL eluent as measured by the Qubit. Net tow samples had 50 mL of concentrate was passed across a 0.22 µm pore size Sterivex filter unit (MilliporeSigma, Burlington, MA, USA), and were extracted with the same modified DNeasy Plant DNA extraction protocol as above, with 4x volumes of AP1 buffer and RNase A and beads added to the unit to account for the larger sample surface area, extraction occurring within the capped unit itself to maximize yield, and then the lysate removed with a sterile syringe and subsequent steps with adjusted volumes as appropriate. As expected, DNA yields were higher from the Sterivex units ranging from 2.4 – 54.0 ng DNA / mL eluent with an average of 13.7 ng DNA/ mL elution as measured by the Qubit. For the March 13, 2017 NBay samples, 125 mL of surface seawater was passed across a HV filter and extracted with the DNeasy Plant DNA extraction kit with scissors and no beads. As measured by the Qubit, the average DNA yield was 3.7 ng DNA / mL eluent. A negative control sample was prepared of a blank 25 mm 5.0 mm polyester membrane filter using extraction reagents which had no detectable DNA using the Qubit. There were two positive controls of mock communities comprised of two known Pseudo-nitzschia species from monocultures. The two Pseudo-nitzschia cultures were P. subcurvata collected from the Southern Ocean and P. pungens isolated from NBay (provided by J. Rines). One positive control was made by combining equal concentrations of extracted DNA with 1.0 ng DNA of each culture. The second positive control was created of equal cell abundance estimated to be captured onto the filters of the cultures prior to extraction. These negative and positive controls were prepared for sequencing and sequenced on the same plate as the other environmental samples.&lt;/p&gt; &lt;p&gt;&lt;br /&gt; The ITS1 has been targeted for amplification and analysis by ARISA previously for Pseudo-nitzschia identification in environmental samples (Hubbard, Rocap, and Armbrust 2008). A comparison of ITS1 appears to be much less conserved and is divergent enough across Pseudo-nitzschia that 41 different species can be identified using existing public sequencing data. The primers to target the ITS1 region of Pseudo-nitzschia used this existing forward primer sequence of the ITS1 region for eukaryotes: TCCGTAGGTGAACCTGCGG (White et al. 1990) and a custom reverse primer designed using 132 Pseudo-nitzschia ITS1 sequences from the NCBI nucleotide database (downloaded on 4/3/2019) from this nucleotide search: ((Pseudo-nitzschia[Organism]) AND internal transcribed spacer[Title]) NOT uncultured): CATCCACCGCTGAAAGTTGTAA. This reverse primer targets a conserved region in the 5.8S. All primer sequences are reported from 5’ – 3’. MiSeq adapter sequences were added to the beginning of the primer sequences for these full sequences used in this study: forward primer TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCGTAGGTGAACCTGCGG and reverse primer GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATCCACCGCTGAAAGTTGTAA. When checking the specificity of these primers using the NCBI nt database, it became known that sequences beyond Pseudo-nitzschia would also be amplified in this study including other diatoms and dinoflagellates; however, the large number of sequencing reads recovered on the MiSeq platform would circumvent this non-specific characteristic of the primers.&lt;/p&gt; &lt;p&gt;The accession numbers of the sequences used in this primer design are reported in Table S2 of Sterling et al. (in prep), along with a summary of Pseudo-nitzschia species expected to amplify with these based on the in silico design. The expected ranges for PCR products were from 235 – 370 bp as the size of the ITS1 region differs for some Pseudo-nitzschia taxa. Primers (Integrated DNA Technologies, Coralville, IA, USA) were HPLC purified, resuspended in 1x Tris-Acetate-EDTA (TAE) buffer, and then working stocks created in diethylpyrocarbonate (DEPC)-treated H2O. About 4 ng of extracted DNA was used for each PCR reaction. If, according to the Qubit quantification, the DNA concentration was less than 2 ng mL-1 or below the limit of detection, it was then used as is, and just 2 mL was added to the PCR reaction. PCR reactions were set up on ice, in a 1x reaction in 25 mL total volume. Final primer concentration was 0.5 mM and polymerase was Phusion Hot Start High-Fidelity Master Mix (Thermo Fisher Scientific Inc., Waltham, MA, USA). There were two cycles with different annealing temperatures, the first with an annealing temperature specific to the loci-specific region and the second set of cycles with an annealing temperature that also takes the MiSeq adapter sequence into account (Canesi and Rynearson 2016). PCR conditions used were initial denaturation for 30 seconds at 98 °C, 15 cycles of the following: denaturation for 10 seconds at 98 °C, annealing for 30 seconds at 64.1 °C , extension for 30 seconds at 72 °C, and 15 cycles with the same conditions except a higher annealing temperature of 72 °C , and then a final extension for 10 minutes at 72 °C , and a holding temperature of 10 °C until stored in the -20 °C freezer. PCR products were visualized on a 1% agarose gel before submission to the URI Genomics and Sequencing Center (Kington, RI, USA) where library preparation and sequencing were performed on a 2x300 bp MiSeq run (Illumina, Inc., San Diego, CA, USA). There were 193 environmental samples were sequenced, along with two positive controls of Pseudo-nitzschia DNA from cultures and one negative control, for a total of 196 samples using two sets of MiSeq indices on the same sequencing plate. It was deemed appropriate to multiplex this plate as estimated read depth to recover Pseudo-nitzschia sequences was predicted to be lower than usual.&lt;/p&gt; &lt;p&gt;The columns are the library_ID as described in DATASET 01: the identifying sample number that connects the row of environmental data to the corresponding plankton biomass filter that was sequenced for the Pseudo-nitzschia species assemblages. The Sequence Sample ID connect to the sample_title, library_ID and file names in NCBI’s Short Read Archive (SRA) under this related Bioproject #PRJNA690940.&lt;/p&gt; &lt;p&gt;The rows are the Sequence_of_ASV as described in DATASET 02: the DNA sequence of the internal transcribed spacer (ITS) 1 region used to identify the Pseudo-nitzschia [NCBI:txid41953] species. Only ASVs shown pass the threshold of accounting for &amp;gt; 1% relative abundance in a sample.&lt;/p&gt; &lt;p&gt;The matrix is filled in indicating whether or not that specific ASV sequence was present in that corresponding sample with 1 = Present and 0 = Absent.&lt;/p&gt; &lt;p&gt;Problem report:&amp;nbsp;Sample #AS424 had no ASVs belonging to &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;sp. and was removed.&lt;/p&gt; Specified by the Principal Investigator(s) &lt;p&gt;A custom bioinformatics pipeline was utilized. CutAdapt (Martin 2011) was used to trim Illumina MiSeq adapters and primer sequences. Primer sequences were trimmed from both ends of sequences, with the reverse complement of the other primer trimmed the end of the sequences. If reads did not have the ITS1 primer sequence, they were discarded. Reads needed to be one base pair (bp) or longer to continue in the pipeline. Trimmed sequences were inputted into DADA2 (v. 1.16)&amp;nbsp; to determine amplicon sequence variants (ASVs; Callahan et al. 2016). ASVs were retained at that level, with some potentially having as few differences as one bp to each other, for the subsequent analysis. ASVs were identified as &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;taxa using a curated database from NCBI sequences (Table S2 in Sterling et al. in prep) which used to design primers to assign taxonomy for ITS1 ASVs trimmed of the primer sequences using the scikit-learn naïve Bayes machine learning classifier (Pedregosa et al. 2011) at default settings in QIIME2 (Bolyen et al. 2019). The scikit-learn naïve Bayes machine learning classifier identified 97 ASVs as &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;at the species level. Three of these ASVs belonged to &lt;em&gt;P. subcurvata &lt;/em&gt;from the positive control mock community and were removed from analysis. All of the 6,503 ASVs recovered from the 192 non-control samples from the sequencing effort were run through a megablast search using BLAST+ version 2.9 with the nucleaotide (nt) database downloaded on October 4, 2020. There were 540 ASVs which had a known &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;taxa, including clones, vouchers, and environmental samples, as its top megablast hit. In addition to the 97 ASVs identified as a specific &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;species from the QIIME2 pipeline, there were 115 ASVs identified as a &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;taxa with greater than 75% query coverage were manually examined. It was determined by judgement call that the 11 ASVs which were identified as &lt;em&gt;P. pungens &lt;/em&gt;PC50 were likely &lt;em&gt;Cylindrotheca &lt;/em&gt;instead and the 85 ASVs which were closest related to &lt;em&gt;P. delicatissima &lt;/em&gt;KJ22-0.2-69 environmental clone was most closely related to known &lt;em&gt;Nitzschia &lt;/em&gt;isolate sequence from subsequent BLAST searches. This left 19 ASVs of interest, with 9 of them have &amp;gt;98% query coverage and &amp;gt;98% identity with known &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;sequences so were referred to as the specific &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;species and 10 ASVs were identified as the genus with identifiers of similar groups of ASVs to each other. These genus level ASVs have &amp;lt; 96% identity to existing sequences in the database. In total, there were 113 ASVs from the 192 samples that appeared to be of reliable &lt;em&gt;Pseudo-nitzschia &lt;/em&gt;origin. Sample #AS424 had none of the 113 ASVs and was removed. Read counts were transformed into relative abundance out of total &lt;em&gt;Pseudo-nitzschia&lt;/em&gt; taxa reads. If an ASV accounted for &amp;lt; 1% relative abundance in a sample, then it was considered “not present” or absent to avoid potentially spurious results. This removed 60 ASVs which only occurred in &amp;lt; 1% of reads in samples. The remaining 53 ASVs were used in the analysis in a presence/absence matrix to avoid potential problems from inflating read numbers with cell counts. This threshold retained 46 of the 97 scikit-learn classifier identified ASVs, and seven of the ASVs added by the megablast curation. Of the seven ASVs added from megablast results, three ASVs where in a group together at the genus level, and around 95% identity with known &lt;em&gt;P. americana&lt;/em&gt; sequences. The other megablast added ASVs were very closely related to &lt;em&gt;P. cuspidata&lt;/em&gt; and &lt;em&gt;P. calliantha&lt;/em&gt;.&lt;/p&gt; &lt;p&gt;&lt;strong&gt;BCO-DMO Processing Notes:&lt;/strong&gt;&lt;br /&gt; - data were submitted in&amp;nbsp;file &quot;DATA03_ASVTable_Sterling_NBay.csv&quot;.&lt;br /&gt; -&amp;nbsp;added conventional header with dataset name, PI name, version date&lt;br /&gt; - columns and rows were flipped to allow better viewing (would be extremely wide if not pivoted)&lt;/p&gt; Specified by the Principal Investigator(s) asNeeded 7.x-1.1 Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact Illumina MiSeq Next Generation Sequencing (University of Rhode Island Genomics and Sequencing Center) Illumina MiSeq Next Generation Sequencing (University of Rhode Island Genomics and Sequencing Center) PI Supplied Instrument Name: Illumina MiSeq Next Generation Sequencing (University of Rhode Island Genomics and Sequencing Center) Instrument Name: Automated DNA Sequencer Instrument Short Name:Automated Sequencer Instrument Description: A DNA sequencer is an instrument that determines the order of deoxynucleotides in deoxyribonucleic acid sequences. Cruise: EN608 EN608 R/V Endeavor Community Standard Description International Council for the Exploration of the Sea R/V Endeavor vessel EN608 Heidi M. Sosik Woods Hole Oceanographic Institution Cruise: EN617 EN617 R/V Endeavor Community Standard Description International Council for the Exploration of the Sea R/V Endeavor vessel EN617 Heidi M. Sosik Woods Hole Oceanographic Institution Cruise: EN627 EN627 R/V Endeavor Community Standard Description International Council for the Exploration of the Sea R/V Endeavor vessel EN627 Heidi M. Sosik Woods Hole Oceanographic Institution Cruise: EN644 EN644 R/V Endeavor Community Standard Description International Council for the Exploration of the Sea R/V Endeavor vessel EN644 Heidi M. Sosik Woods Hole Oceanographic Institution R/V Endeavor Community Standard Description International Council for the Exploration of the Sea R/V Endeavor vessel