http://lod.bco-dmo.org/id/dataset/883055 eng; USA utf8 dataset Highest level of data collection, from a common set of sensors or instrumentation, usually within the same research project Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact 2022-10-27 ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data ISO 19115-2:2009(E) Quantitative PCR cell count estimates from samples of DNA extracted from seagrass wasting disease parasite, Labyrinthula zosterae from wasting disease mesocosm experiments at Bodega Marine Laboratory in July-Sept of 2015 2022-10-27 publication 2022-10-27 revision Marine Biological Laboratory/Woods Hole Oceanographic Institution Library (MBLWHOI DLA) 2022-11-22 publication https://doi.org/10.26008/1912/bco-dmo.883055.1 A. Randall Hughes Northeastern University principalInvestigator Katherine DuBois University of California-Davis principalInvestigator Melissa Kardish University of California-Davis principalInvestigator Forest Schenck Northeastern University principalInvestigator John J. Stachowicz University of California-Davis principalInvestigator Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. publisher Cite this dataset as: Schenck, F., DuBois, K., Kardish, M., Stachowicz, J. J., Hughes, A. R. (2022) Quantitative PCR cell count estimates from samples of DNA extracted from seagrass wasting disease parasite, Labyrinthula zosterae from wasting disease mesocosm experiments at Bodega Marine Laboratory in July-Sept of 2015. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2022-10-27 [if applicable, indicate subset used]. doi:10.26008/1912/bco-dmo.883055.1 [access date] Methods and Sampling: &lt;p&gt;We used a substitutive design to test the effects of eelgrass (Zostera marina) genotypic identity (eight genotypes), diversity (monocultures of 1 genotype vs. polycultures of 4 genotypes), and temperature (ambient or + 3.2° C) on the prevalence and intensity of&amp;nbsp;&lt;em&gt;Labyrinthula&lt;/em&gt;&amp;nbsp;over eight weeks (July – September) in an array of flow-through 120-L mesocosms at the Bodega Marine Laboratory in Bodega Bay, CA. At the end of the experiment we collected and preserved the top half of the focal leaf in individual plastic bags sealed with 30 ml of silica (Flower Drying Art Silica Gel; Activa) for subsequent DNA extraction and quantitative PCR to estimate&amp;nbsp;&lt;em&gt;Labyrinthula zosterae&lt;/em&gt;&amp;nbsp;cells as a proxy for infection (Bergmann et al. 2011, Bockelmann et al. 2013, Groner et al. 2021).&lt;/p&gt; &lt;p&gt;We extracted&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;DNA from dried leaf tissue using Omega Bio-Tek E.Z. Tissue DNA extraction kits at the Northeastern University Marine Science Center in Nahant, MA. For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany) at a frequency of 30 Hz for 5 min (Bockelmann et al. 2013). We lysed ground subsamples individually following the manufacturer’s instructions and added 1 uL of 500 ng*uL&lt;sup&gt;-1&lt;/sup&gt;&amp;nbsp;salmon sperm DNA solution (Invitrogen, USA) to the first subsample of each sample immediately before recombining all subsamples in the spin columns. Salmon sperm DNA was added to enhance extraction efficiency and ensure that even low amounts of target DNA are carried through the filter absorption steps (Bockelmann et al. 2013). We eluted all DNA extractions into 100 uL. Following elution, we used Zymo OneStep-96 PCR Inhibitor Removal kits to clean 50 uL sub-samples of each DNA extraction following the manufacturers instructions. We stored cleaned DNA extractions at -20˚C prior to quantitative PCR.&lt;/p&gt; &lt;p&gt;We used a TaqMan quantitative PCR (qPCR) assay with a forward primer: TTGAACGTAACATT-CGACTTTCGT, reverse primer: ACGCATGAAGCGGTCTTCTT, and MBG probe: TGGACGAGTGTGTTTTG that carries the fluorescence label 6-Fam at the 5’ end and the dark quencher FHQ at the 3’ end (Bio-Rad, USA) developed specifically for&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;(Bockelmann et al. 2013, Bergmann et al. 2011). We made up qPCR reactions to a 10 uL reaction volume using standard conditions recommended by the manufacturer: 5 uL SsoAdvanced&lt;sup&gt;TM&lt;/sup&gt;&amp;nbsp;Universal Probes Supermix 2x (Bio-Rad, USA), 1 uL template DNA, 0.4 uL 4:1 Primer:Probe Mix (final concentrations of 400 nM forward primer, 400 nM reverse primer, 100 nM probe), and 3.6 uL Milli-Q H&lt;sub&gt;2&lt;/sub&gt;O (Thermofisher, USA). Reactions were run on a CFX96 Real-Time System (Bio-Rad, USA) using the following thermo-cycling program: 3 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C and 1 min at 60˚C. We tested all samples in duplicate and if replicates differed by greater than one cycle threshold (Ct) reactions were rerun in triplicate. We only used the data from reactions in analyses when replicates fell within one Ct. Our lowest detection was 1.76 copies per reaction or 0.15 cells per extraction.&lt;/p&gt; &lt;p&gt;We ran each 96-well plate of qPCR reactions with a set of nine standards: a dilution series of gBlock Gene Fragments (Integrated DNA Technologies, USA) designed based on the highly conserved sequence of the 5.8s ribosomal RNA gene of&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;known as internal transcribed spacer 1 (ITS) targeted by the TaqMan qPCR assay; an&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cell standard consisting of a sample of DNA extracted from a know quantity of pathogenic&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cells; and an inhibition control consisting of a half volume of&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cell standard and a half volume of a haphazardly selected sample. We ran a total of 31 96-well plates of qPCR reactions with a mean efficiency of 97.4% ± 4.3 and R&lt;sup&gt;2&lt;/sup&gt;&amp;nbsp;0.996 ± 0.004.&amp;nbsp;&lt;/p&gt; &lt;p&gt;&amp;nbsp;Specifically, we first converted Ct values to copy numbers as our g-block standard curve were in units of copy number. We then used the&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell standard to determine the copy number per&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell. Finally, we converted copy number to&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cells * mg dw&lt;sup&gt;-1&lt;/sup&gt;. Copy numbers per cell in our reactions were 1227.58 ± 80.66 (mean ± SE).&lt;/p&gt; &lt;p&gt;We used a pure culture of the pathogenic&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;isolate 316b provided by D. Martin in 2015 to make our&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell standard (Martin et al. 2016; GenBank: KU559372.1). We cultured&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cells on serum seawater agar media (Muehlstein et al. 1991). We scraped cells from an actively growing edge of&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;culture into serum seawater liquid media (D. Martin pers. com.). We mixed the liquid media-&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell slurry vigorously on a bench top vortex for 30 sec and aliquoted immediately into three replicate subsamples for cell counts and extraction. In order to break up cell clumps for ease of counting, we added Tween80 (Sigma-Aldrich, USA) to a final concentration of 1:100 into the two subsamples used for cell counts, and mixed for 30 sec. We counted cells of four replicate aliquots per subsample on a hemocytometer. We calculated cell concentration by averaging over all replicates. Prior to DNA extraction, we centrifuged the third replicate&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell solution at 6,000 g for 10 min and drew off the supernatant without disturbing the cell pellet. We then added a ~4 mg section of dried healthy&amp;nbsp;&lt;em&gt;Z. marina&lt;/em&gt;&amp;nbsp;tissue to the cell pellet to account for possible interference of&amp;nbsp;&lt;em&gt;Z. marina&lt;/em&gt;&amp;nbsp;compounds in the extraction process. To extract&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;DNA, we followed the DNA extraction and inhibitor removal protocols outlined above.&lt;/p&gt; &lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; We designed the gBlock double stranded DNA fragments (Integrated DNA Technologies, USA) using published sequences of the ITS region of the&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;genome (GenBank: JN121409-13).&lt;/p&gt; &lt;p&gt;5’-CTGTGATCTCTGAAAATACTTGTTT (1)&lt;u&gt;TTGAACGTAACATTCGACTTTCGT&lt;/u&gt;CGATT TTG (2)&lt;u&gt;TGGACGAGTGTGTTTTGT&amp;nbsp;&lt;/u&gt;AAACCTACCC (3)&lt;u&gt;AAGAAGACCGCTTCATGCGT&amp;nbsp;&lt;/u&gt;GTCGCTGACTAATGAAACAAACAAA-3’&lt;/p&gt; &lt;p&gt;The gBlock fragment sequences were a total length of 130 bp, which included target regions for the forward (1) and reverse (3) primers and the MGD probe (2), underlined above, as well as 25 base pairs of additional sequence on both the 5’ and 3’ ends to increase fragment stability. We diluted gBlock fragments in Milli-Q H&lt;sub&gt;2&lt;/sub&gt;O (Thermofisher, USA) to seven concentrations: 2.24e&lt;sup&gt;1&lt;/sup&gt;, 1.12e&lt;sup&gt;2&lt;/sup&gt;, 5.61e&lt;sup&gt;2&lt;/sup&gt;, 2.81e&lt;sup&gt;3&lt;/sup&gt;, 1.40e&lt;sup&gt;4&lt;/sup&gt;, 7.02e&lt;sup&gt;4&lt;/sup&gt;, 7.02e&lt;sup&gt;5&lt;/sup&gt;&amp;nbsp;copies/µL and included this dilution series in each qPCR run as a standard curve (Bergmann et al. 2011). The range of the gBlock dilution curve: approx. 1-60,000 cells/extraction encompassed the range of most&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;values observed in our samples: 0.15-450,000 cells/extraction or 1.84e&lt;sup&gt;2&lt;/sup&gt;-5.52e&lt;sup&gt;8&lt;/sup&gt;&amp;nbsp;copies/extraction.&lt;br /&gt; &lt;br /&gt; &lt;strong&gt;Life Sciences Identifiers (LSID) for taxonomic names:&lt;/strong&gt;&lt;br /&gt; Zostera marina (urn:lsid:marinespecies.org:taxname:145795)&lt;br /&gt; Labyrinthula zosterae (urn:lsid:marinespecies.org:taxname:395093)&lt;br /&gt; Labyrinthula (urn:lsid:marinespecies.org:taxname:119090)&lt;/p&gt; Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1652320 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=1652320 completed A. Randall Hughes Northeastern University 781-581-7370 430 Nahant Rd. Nahant MA 01908 USA ann.hughes@northeastern.edu pointOfContact Katherine DuBois University of California-Davis Bowdoin College Schiller Coastal Studies Center 6775 College Station Brunswick ME 04011-8479 USA khoering@gmail.com pointOfContact Melissa Kardish University of California-Davis 707-875-1968 University of California Davis Bodega Marine Lab P.O.Box 247, 2099 Westshore Road Bodega Bay CA 94923 USA mrkardish@ucdavis.edu pointOfContact Forest Schenck Northeastern University 30 Emerson Avenue Gloucester MA 01930 USA forest.schenck@mass.gov pointOfContact John J. Stachowicz University of California-Davis 530-752-1113 Department of Evolution and Ecology 1 Shields Ave Davis CA 95616 USA jjstachowicz@ucdavis.edu pointOfContact asNeeded Dataset Version: 1 Unknown trial_no inhibition_sample_plate_id inhibition_sample_well_id cells_uL_sample cells_uL_pos_cntrl cells_uL_inhibition inhibition_cntrl_ID flow through tanks Retsch Mixer Mill 400 Bio-Rad CFX96 Real-Time System theme None, User defined experiment id sample description cell_concentration featureType BCO-DMO Standard Parameters Aquarium Homogenizer qPCR Thermal Cycler instrument BCO-DMO Standard Instruments otherRestrictions otherRestrictions Access Constraints: none. Use Constraints: Please follow guidelines at: http://www.bco-dmo.org/terms-use Distribution liability: Under no circumstances shall BCO-DMO be liable for any direct, incidental, special, consequential, indirect, or punitive damages that result from the use of, or the inability to use, the materials in this data submission. If you are dissatisfied with any materials in this data submission your sole and exclusive remedy is to discontinue use. CAREER: Linking genetic diversity, population density, and disease prevalence in seagrass and oyster ecosystems https://osprey.bco-dmo.org/project/709942 CAREER: Linking genetic diversity, population density, and disease prevalence in seagrass and oyster ecosystems <p><em>NSF Award Abstract:</em><br /> Disease outbreaks in the ocean are increasing, causing losses of ecologically important marine species, but the factors contributing to these outbreaks are not well understood. This 5-year CAREER project will study disease prevalence and intensity in two marine foundation species - the seagrass Zostera marina and the Eastern oyster Crassostrea virginica. More specifically, host-disease relationships will be explored to understand how genetic diversity and population density of the host species impacts disease transmission and risk. This work will pair large-scale experimental restorations and smaller-scale field experiments to examine disease-host relationships across multiple spatial scales. Comparisons of patterns and mechanisms across the two coastal systems will provide an important first step towards identifying generalities in the diversity-density-disease relationship. To enhance the broader impacts and utility of this work, the experiments will be conducted in collaboration with restoration practitioners and guided by knowledge ascertained from key stakeholder groups. The project will support the development of an early career female researcher and multiple graduate and undergraduate students. Students will be trained in state-of-the-art molecular techniques to quantify oyster and seagrass parasites. Key findings from the surveys and experimental work will be incorporated into undergraduate courses focused on Conservation Biology, Marine Biology, and Disease Ecology. Finally, students in these courses will help develop social-ecological surveys and mutual learning games to stimulate knowledge transfer with stakeholders through a series of workshops.</p> <p>The relationship between host genetic diversity and disease dynamics is complex. In some cases, known as a dilution effect, diversity reduces disease transmission and risk. However, the opposite relationship, known as the amplification effect, can also occur when diversity increases the risk of infection. Even if diversity directly reduces disease risk, simultaneous positive effects of diversity on host density could lead to amplification by increasing disease transmission between infected and uninfected individuals. Large-scale field restorations of seagrasses (Zostera marina) and oysters (Crassostrea virginica) will be utilized to test the effects of host genetic diversity on host population density and disease prevalence/intensity. Additional field experiments independently manipulating host genetic diversity and density will examine the mechanisms leading to dilution or amplification. Conducting similar manipulations in two marine foundation species - one a clonal plant and the other a non-clonal animal - will help identify commonalities in the diversity-density-disease relationship. Further, collaborations among project scientists, students, and stakeholders will enhance interdisciplinary training and help facilitate the exchange of information to improve management and restoration efforts. As part of these efforts, targeted surveys will be used to document the perceptions and attitudes of managers and restoration practitioners regarding genetic diversity and its role in ecological resilience and restoration.</p> Seagrass and Oyster Ecosystems largerWorkCitation project eng; USA oceans -123.06572 -123.06572 38.31753 38.31753 2015-07-01 2015-09-14 Coastal New England 0 BCO-DMO catalogue of parameters from Quantitative PCR cell count estimates from samples of DNA extracted from seagrass wasting disease parasite, Labyrinthula zosterae from wasting disease mesocosm experiments at Bodega Marine Laboratory in July-Sept of 2015 Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact http://lod.bco-dmo.org/id/dataset-parameter/883539.rdf Name: trial_no Units: unitless Description: <p>Unique identifier number assigned to each of the 31 96-well plate quantitative PCR reactions</p> http://lod.bco-dmo.org/id/dataset-parameter/883540.rdf Name: inhibition_sample_plate_id Units: unitless Description: <p>Unique identifier alphanumeric code assigned to each of the nine Zostera marina tissue DNA extraction 96-well plates</p> http://lod.bco-dmo.org/id/dataset-parameter/883541.rdf Name: inhibition_sample_well_id Units: unitless Description: <p>Unique identifier alphanumeric code assigned to each well in each of the nine Zostera marina tissue DNA extraction 96-well plates</p> http://lod.bco-dmo.org/id/dataset-parameter/883542.rdf Name: cells_uL_sample Units: L. zosterae cells per microliter (cells/uL) Description: <p>The number of Labyrinthula zosterae cells detected by quantitative-PCR from DNA extracted from a tissue segment of the focal leaf of a Zostera marina plant per uL of DNA extraction solution</p> http://lod.bco-dmo.org/id/dataset-parameter/883543.rdf Name: cells_uL_pos_cntrl Units: L. zosterae cells per microliter (cells/uL) Description: <p>The number of Labyrinthula zosterae cells detected by quantitative-PCR from DNA extracted from a tissue segment of the focal leaf of cultured L. zosterae cells per uL of DNA extraction solution. (L. zosterae cells * uL-1).</p> http://lod.bco-dmo.org/id/dataset-parameter/883544.rdf Name: cells_uL_inhibition Units: L. zosterae cells per microliter (cells/uL) Description: <p>The number of Labyrinthula zosterae cells detected by quantitative-PCR from DNA extracted from tissue of the focal leaf of a Zostera marina plant combined with DNA extracted from cultured L. zosterae cells per uL of DNA extraction solution to test for inhibition. (L. zosterae cells * uL-1).</p> http://lod.bco-dmo.org/id/dataset-parameter/883545.rdf Name: inhibition_cntrl_ID Units: unitless Description: <p>Unique identifier associated with the culture of Labyrinthula zosterae cells used in each inhibition control trial. (L. zosterae cells * uL-1).</p> GB/NERC/BODC > British Oceanographic Data Centre, Natural Environment Research Council, United Kingdom Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact 1188 https://darchive.mblwhoilibrary.org/bitstream/1912/29523/1/dataset-883055_mesocosm-warming-experiment-quantitative-pcr-inhibition-controls__v1.tsv download https://doi.org/10.26008/1912/bco-dmo.883055.1 download onLine dataset &lt;p&gt;We used a substitutive design to test the effects of eelgrass (Zostera marina) genotypic identity (eight genotypes), diversity (monocultures of 1 genotype vs. polycultures of 4 genotypes), and temperature (ambient or + 3.2° C) on the prevalence and intensity of&amp;nbsp;&lt;em&gt;Labyrinthula&lt;/em&gt;&amp;nbsp;over eight weeks (July – September) in an array of flow-through 120-L mesocosms at the Bodega Marine Laboratory in Bodega Bay, CA. At the end of the experiment we collected and preserved the top half of the focal leaf in individual plastic bags sealed with 30 ml of silica (Flower Drying Art Silica Gel; Activa) for subsequent DNA extraction and quantitative PCR to estimate&amp;nbsp;&lt;em&gt;Labyrinthula zosterae&lt;/em&gt;&amp;nbsp;cells as a proxy for infection (Bergmann et al. 2011, Bockelmann et al. 2013, Groner et al. 2021).&lt;/p&gt; &lt;p&gt;We extracted&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;DNA from dried leaf tissue using Omega Bio-Tek E.Z. Tissue DNA extraction kits at the Northeastern University Marine Science Center in Nahant, MA. For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany) at a frequency of 30 Hz for 5 min (Bockelmann et al. 2013). We lysed ground subsamples individually following the manufacturer’s instructions and added 1 uL of 500 ng*uL&lt;sup&gt;-1&lt;/sup&gt;&amp;nbsp;salmon sperm DNA solution (Invitrogen, USA) to the first subsample of each sample immediately before recombining all subsamples in the spin columns. Salmon sperm DNA was added to enhance extraction efficiency and ensure that even low amounts of target DNA are carried through the filter absorption steps (Bockelmann et al. 2013). We eluted all DNA extractions into 100 uL. Following elution, we used Zymo OneStep-96 PCR Inhibitor Removal kits to clean 50 uL sub-samples of each DNA extraction following the manufacturers instructions. We stored cleaned DNA extractions at -20˚C prior to quantitative PCR.&lt;/p&gt; &lt;p&gt;We used a TaqMan quantitative PCR (qPCR) assay with a forward primer: TTGAACGTAACATT-CGACTTTCGT, reverse primer: ACGCATGAAGCGGTCTTCTT, and MBG probe: TGGACGAGTGTGTTTTG that carries the fluorescence label 6-Fam at the 5’ end and the dark quencher FHQ at the 3’ end (Bio-Rad, USA) developed specifically for&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;(Bockelmann et al. 2013, Bergmann et al. 2011). We made up qPCR reactions to a 10 uL reaction volume using standard conditions recommended by the manufacturer: 5 uL SsoAdvanced&lt;sup&gt;TM&lt;/sup&gt;&amp;nbsp;Universal Probes Supermix 2x (Bio-Rad, USA), 1 uL template DNA, 0.4 uL 4:1 Primer:Probe Mix (final concentrations of 400 nM forward primer, 400 nM reverse primer, 100 nM probe), and 3.6 uL Milli-Q H&lt;sub&gt;2&lt;/sub&gt;O (Thermofisher, USA). Reactions were run on a CFX96 Real-Time System (Bio-Rad, USA) using the following thermo-cycling program: 3 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C and 1 min at 60˚C. We tested all samples in duplicate and if replicates differed by greater than one cycle threshold (Ct) reactions were rerun in triplicate. We only used the data from reactions in analyses when replicates fell within one Ct. Our lowest detection was 1.76 copies per reaction or 0.15 cells per extraction.&lt;/p&gt; &lt;p&gt;We ran each 96-well plate of qPCR reactions with a set of nine standards: a dilution series of gBlock Gene Fragments (Integrated DNA Technologies, USA) designed based on the highly conserved sequence of the 5.8s ribosomal RNA gene of&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;known as internal transcribed spacer 1 (ITS) targeted by the TaqMan qPCR assay; an&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cell standard consisting of a sample of DNA extracted from a know quantity of pathogenic&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cells; and an inhibition control consisting of a half volume of&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cell standard and a half volume of a haphazardly selected sample. We ran a total of 31 96-well plates of qPCR reactions with a mean efficiency of 97.4% ± 4.3 and R&lt;sup&gt;2&lt;/sup&gt;&amp;nbsp;0.996 ± 0.004.&amp;nbsp;&lt;/p&gt; &lt;p&gt;&amp;nbsp;Specifically, we first converted Ct values to copy numbers as our g-block standard curve were in units of copy number. We then used the&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell standard to determine the copy number per&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell. Finally, we converted copy number to&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cells * mg dw&lt;sup&gt;-1&lt;/sup&gt;. Copy numbers per cell in our reactions were 1227.58 ± 80.66 (mean ± SE).&lt;/p&gt; &lt;p&gt;We used a pure culture of the pathogenic&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;isolate 316b provided by D. Martin in 2015 to make our&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell standard (Martin et al. 2016; GenBank: KU559372.1). We cultured&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;cells on serum seawater agar media (Muehlstein et al. 1991). We scraped cells from an actively growing edge of&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;culture into serum seawater liquid media (D. Martin pers. com.). We mixed the liquid media-&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell slurry vigorously on a bench top vortex for 30 sec and aliquoted immediately into three replicate subsamples for cell counts and extraction. In order to break up cell clumps for ease of counting, we added Tween80 (Sigma-Aldrich, USA) to a final concentration of 1:100 into the two subsamples used for cell counts, and mixed for 30 sec. We counted cells of four replicate aliquots per subsample on a hemocytometer. We calculated cell concentration by averaging over all replicates. Prior to DNA extraction, we centrifuged the third replicate&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;cell solution at 6,000 g for 10 min and drew off the supernatant without disturbing the cell pellet. We then added a ~4 mg section of dried healthy&amp;nbsp;&lt;em&gt;Z. marina&lt;/em&gt;&amp;nbsp;tissue to the cell pellet to account for possible interference of&amp;nbsp;&lt;em&gt;Z. marina&lt;/em&gt;&amp;nbsp;compounds in the extraction process. To extract&amp;nbsp;&lt;em&gt;L. zosterae&amp;nbsp;&lt;/em&gt;DNA, we followed the DNA extraction and inhibitor removal protocols outlined above.&lt;/p&gt; &lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; We designed the gBlock double stranded DNA fragments (Integrated DNA Technologies, USA) using published sequences of the ITS region of the&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;genome (GenBank: JN121409-13).&lt;/p&gt; &lt;p&gt;5’-CTGTGATCTCTGAAAATACTTGTTT (1)&lt;u&gt;TTGAACGTAACATTCGACTTTCGT&lt;/u&gt;CGATT TTG (2)&lt;u&gt;TGGACGAGTGTGTTTTGT&amp;nbsp;&lt;/u&gt;AAACCTACCC (3)&lt;u&gt;AAGAAGACCGCTTCATGCGT&amp;nbsp;&lt;/u&gt;GTCGCTGACTAATGAAACAAACAAA-3’&lt;/p&gt; &lt;p&gt;The gBlock fragment sequences were a total length of 130 bp, which included target regions for the forward (1) and reverse (3) primers and the MGD probe (2), underlined above, as well as 25 base pairs of additional sequence on both the 5’ and 3’ ends to increase fragment stability. We diluted gBlock fragments in Milli-Q H&lt;sub&gt;2&lt;/sub&gt;O (Thermofisher, USA) to seven concentrations: 2.24e&lt;sup&gt;1&lt;/sup&gt;, 1.12e&lt;sup&gt;2&lt;/sup&gt;, 5.61e&lt;sup&gt;2&lt;/sup&gt;, 2.81e&lt;sup&gt;3&lt;/sup&gt;, 1.40e&lt;sup&gt;4&lt;/sup&gt;, 7.02e&lt;sup&gt;4&lt;/sup&gt;, 7.02e&lt;sup&gt;5&lt;/sup&gt;&amp;nbsp;copies/µL and included this dilution series in each qPCR run as a standard curve (Bergmann et al. 2011). The range of the gBlock dilution curve: approx. 1-60,000 cells/extraction encompassed the range of most&amp;nbsp;&lt;em&gt;L. zosterae&lt;/em&gt;&amp;nbsp;values observed in our samples: 0.15-450,000 cells/extraction or 1.84e&lt;sup&gt;2&lt;/sup&gt;-5.52e&lt;sup&gt;8&lt;/sup&gt;&amp;nbsp;copies/extraction.&lt;br /&gt; &lt;br /&gt; &lt;strong&gt;Life Sciences Identifiers (LSID) for taxonomic names:&lt;/strong&gt;&lt;br /&gt; Zostera marina (urn:lsid:marinespecies.org:taxname:145795)&lt;br /&gt; Labyrinthula zosterae (urn:lsid:marinespecies.org:taxname:395093)&lt;br /&gt; Labyrinthula (urn:lsid:marinespecies.org:taxname:119090)&lt;/p&gt; Specified by the Principal Investigator(s) &lt;p&gt;Code that includes quantitative PCR inhibition analysis associated with this experiment:&lt;br /&gt; All code was written and run in R (version 3.6.1, www.R-project.org). Github repository&amp;nbsp;https://github.com/schenckf/BWE_Experiment V2.0.0 archived at&amp;nbsp;Zenodo (DOI: &lt;a href=&quot;https://doi.org/10.5281/zenodo.7129500&quot;&gt;10.5281/zenodo.7129500&lt;/a&gt;). A general description of the code is included in the repository release in file &quot;Analysis Description.docx.&quot;&lt;/p&gt; &lt;div&gt;BCO-DMO Processing:&lt;/div&gt; &lt;div&gt;- Imported data from source file &quot;mesocosm_warming_experiment_quantitativePCR_inhibition_control_data.csv&quot; into the BCO-DMO data system. Data file imported using missing data identifier &quot;NA&quot;.&lt;br /&gt; - Modified parameter (column) names to conform with BCO-DMO naming conventions.&lt;/div&gt; Specified by the Principal Investigator(s) asNeeded 7.x-1.1 Biological and Chemical Oceanography Data Management Office (BCO-DMO) Unavailable 508-289-2009 WHOI MS#36 Woods Hole MA 02543 USA info@bco-dmo.org http://www.bco-dmo.org Monday - Friday 8:00am - 5:00pm For questions regarding this resource, please contact BCO-DMO via the email address provided. pointOfContact flow through tanks flow through tanks PI Supplied Instrument Name: flow through tanks Instrument Name: Aquarium Instrument Short Name:Aquarium Instrument Description: Aquarium - a vivarium consisting of at least one transparent side in which water-dwelling plants or animals are kept Retsch Mixer Mill 400 Retsch Mixer Mill 400 PI Supplied Instrument Name: Retsch Mixer Mill 400 PI Supplied Instrument Description:For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany)  Instrument Name: Homogenizer Instrument Short Name:Homogenizer Instrument Description: A homogenizer is a piece of laboratory equipment used for the homogenization of various types of material, such as tissue, plant, food, soil, and many others. Bio-Rad CFX96 Real-Time System Bio-Rad CFX96 Real-Time System PI Supplied Instrument Name: Bio-Rad CFX96 Real-Time System PI Supplied Instrument Description:The focal leaf was stored for subsequent DNA extraction and quantitative PCR to estimate Labyrinthula zosterae cells as a proxy for infection. Software: Bio-Rad CFX Manager Software (version 3.1) Instrument Name: qPCR Thermal Cycler Instrument Short Name:qPCR Instrument Description: An instrument for quantitative polymerase chain reaction (qPCR), also known as real-time polymerase chain reaction (Real-Time PCR).