http://lod.bco-dmo.org/id/dataset/954181
eng; USA
utf8
dataset
Highest level of data collection, from a common set of sensors or instrumentation, usually within the same research project
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
2025-02-21
ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data
ISO 19115-2:2009(E)
Molecular identification of genetic variants of Neocalanus flemingeri in the Gulf of Alaska from samples collected from 2015 to 2023
2025-02-21
publication
2025-02-21
revision
Marine Biological Laboratory/Woods Hole Oceanographic Institution Library (MBLWHOI DLA)
2025-04-28
publication
https://doi.org/10.26008/1912/bco-dmo.954181.1
Petra H. Lenz
University of Hawaiʻi at Mānoa
principalInvestigator
Daniel K. Hartline
University of Hawaiʻi at Mānoa
principalInvestigator
Vittoria Roncalli
University of Hawaiʻi at Mānoa
principalInvestigator
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
publisher
Cite this dataset as: Lenz, P. H., Cieslak, M. C., Roncalli, V., Hartline, D. K. (2025) Molecular identification of genetic variants of Neocalanus flemingeri in the Gulf of Alaska from samples collected from 2015 to 2023. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2025-02-21 [if applicable, indicate subset used]. doi:10.26008/1912/bco-dmo.954181.1 [access date]
Dataset Description: <p>The raw sequence data are available through the National Center for Biotechnology Information (NCBI):<br />
RNA-Seq data: BioProjects: PRJNA324453, PRJNA662858, PRJNA496596, PRJNA807352<br />
*&nbsp;Supplemental file "954181_v1_sra-run-table.csv" for SRA accession and BioSample collection information for the four bioprojects.</p> Methods and Sampling: <p><strong>Collections and sample preservation</strong></p>
<p>Collections during the spring and fall were made during oceanographic cruises of the Seward Line Long-term Observation Program (LTOP) and northern Gulf of Alaska Long Term Ecological Research programs (https://nga.lternet.edu/) between 2015 and 2022. Additional samples were collected at nearshore stations (GAK1 and RES2.5) in 2019 and 2023, and in 2019 in the Gulf of Alaska Seamount region from below 1000 m (see map, Supplemental File "collections_regional_map.png").</p>
<p><strong>RNA-Seq Data</strong></p>
<p>Pre-adult <em>Neocalanus flemingeri</em> stage CV were collected from the upper 100 m in April and May from 5 to 6 stations. Upon retrieval of the net (QuadNet, 53 µm mesh), the plankton collection was live sorted under the microscope and preserved in RNALater. In 2019, <em>N.</em> <em>flemingeri</em> were collected in mid-April for an incubation experiment with individuals maintained in the laboratory for up to 2 months before preservation for RNA-Seq (Roncalli et al., 2023). In September, samples were collected from depth (300 to 700 m) using a 0.25 m<sup>2</sup> Multinet (Hydrobios), live sorted and preserved for RNA-Seq immediately or after laboratory incubation. Fall collections were primarily from Prince William Sound (stations PWS2 and KIP2) with the exception of July 2019, when adult females were collected from depth (&gt;1000 m) in the Gulf of Alaska (stations GAK19 and “Quinn deep”).</p>
<p>Sample processing (RNA extraction, library preparation and high-throughput sequencing) has been described previously (Roncalli et al., 2018, 2019, 2021). Paired-end sequencing was done on the Illumina Platform (NextSeq) and short-sequence read lengths were set to either 75 or 150 bp with sequencing depth of 10M or greater. Raw sequence data are available through National Center for Biotechnology Information with additional metadata available through BCO-DMO datasets ids 922330 and&nbsp;914459&nbsp;(Lenz et al., 2024). Raw sequence data were quality checked, sequences with phred scores below 30 were removed, and sequences were trimmed to remove adapters and the first 9 bp (Roncalli et al., 2018). In addition, rRNA transcripts were removed using SortMeRNA (version 4.2.0) (Kopylova et al., 2012). Lineage identification was based on cytochrome <em>c</em> oxidase subunit-1 (mtCOI) reference sequences that were used to establish the sequence differences between the two forms (Machida and Tsuda, 2010). For the RNA-Seq data, a mtCOI reference database was generated using full length sequences for small-form and large-form&nbsp; <em>N. flemingeri</em>, as well as <em>N. plumchrus</em>, <em>N. cristatus</em>, <em>Calanus marshallae</em>, <em>Eucalanus bungii</em> and <em>Metridia pacific </em>(see Supplemental File "species_list_copepods.csv" for additional copepod species name information and taxonomic identifiers). The reference consisted of consensus sequences obtained by comparing sequences downloaded from NCBI and from <em>de novo</em> assemblies (Hartline et al., 2023; Hartline et al.,&nbsp;2024 [BCO-DMO dataset 908689] ). RNA-Seq libraries from each individual were mapped against the mtCOI reference using Bowtie2 (version 2.3.5.1, default options in paired end mode) as described previously for an approach that was originally developed to identify and quantify <em>Calanus</em> congeners in RNA-Seq data (Lenz et al., 2021a,b). Since mtCOI mapping is highly specific, this approach successfully distinguishes between closely related species and genetic lineages.&nbsp; Cross-mapping is minimal, and even between the two <em>N. flemingeri</em> lineages is typically below 2% (maximum 7%). Data analysis involved tallying the number of individuals that mapped to each lineage for each station/year collection. Analysis for spatial and temporal patterns of the number of small vs large form individuals was done by combining data by year from multiple locations, and by combining regional data for both pre-adult and adult individuals to examine interannual differences.</p>
<p><strong>DNA Sequencing</strong></p>
<p>In 2016, additional individuals were collected during the spring and fall cruises for DNA extraction (n=123), amplification of the mtCOI and Sanger sequencing. Individual <em>N. flemingeri </em>were preserved in RNALater prior to DNA extraction using the DNEasy Blood and&nbsp;Tissue Kit (Qiagen). Extracted DNA was amplified using universal DNA primers, LCO1490 and&nbsp;HCO2198, which consistently amplify a 710-bp region of the mitochondrial cytochrome oxidase subunit I gene from a variety of metazoan invertebrates (Folmer et al, 1994). PCR products were checked for expected size using gel electrophoresis, and purified using Qiagen`s Purification Kit prior to Sanger sequencing at the Advanced Studies in Genomics, Proteomics and Bioinformatics (ASGPB) at the University of Hawai‘i at Mānoa. Sequence data were edited for quality using Geneious and searched on NCBI for the closest match using BLAST (Altschul et al., 1990). Top <em>N. flemingeri</em> hits were compared to published lineage-specific sequences (Machida and Tsuda, 2010) for small form vs. large form identification.</p>
<p><strong>Metabarcoding</strong></p>
<p>DNA metabarcoding of bulk samples containing nauplii of <em>N. flemingeri</em> were collected in Resurrection Bay between January and March, 2023, size fractionated and preserved in ethanol (Block, 2024). The small size-fraction of the bulk samples (53 – 210 µm fraction) were extracted for DNA using the Qiagen DNeasy Blood and Tissue Mini Kit with an extended 24-hour proteinase K incubation to ensure adequate lysis. The mtCOI was amplified using the mlCOIintF and jgHCO2198 primers (Leray et al., 2013), sequenced and processed using established pipelines as described elsewhere (Block, 2024). Amplicon sequences were quantified, clustered and identified to lineage using reference sequences downloaded from the MetaZooGene database (Bucklin et al., 2021).&nbsp;The full MZGdb (downloaded July 14, 2023), included global sequences of marine invertebrates, vertebrates, and microbes (https://metazoogene.org/, MetaZooGene &amp; O'Brien, T.&nbsp; (2023)).&nbsp;The two <em>N. flemingeri</em> genetic lineages were represented by two distinct operational taxonomic units (OTUs) that differed by ca. 3%. 10 diagnostic base pairs out of 307 are indicated by the highlighting in the fasta sequences:</p>
<p>&gt;Nf1_Neocalanus flemingeri OTU 1 (small form)</p>
<p>GTCTAGAAATATTGCCCATGCGGGAGGTTCTGTAGACTTCGCTATTTTCTCACTTCATTT</p>
<p>AGCAGGTGTGAGATCTATTTTAGGGGCCGTAAACTTCATTAGAACCCTCGGAAACTTACG</p>
<p>AGTATTTGGTATATTATTAGACCGAATACCTTTATTTGCCTGAGCTGTTCTTATTACTGC</p>
<p>TGTTCTCCTTCTCCTGTCTTTACCAGTATTAGCTGGAGCTATTACAATATTGTTAACAGA</p>
<p>TCGTAACCTAAATACTTCTTTTTATGATGTTGGCGGGGGCGGTGACCCTATTCTGTACCA</p>
<p>GCATCTA</p>
<p>&nbsp;</p>
<p>&gt;Nf2_Neocalanus flemingeri OTU2 (large form)</p>
<p>CTCTAGAAATATTGCCCATGCGGGAGGTTCTGTAGACTTCGCTATTTTCTCACTTCACTT</p>
<p>GGCAGGTGTGAGATCTATTTTAGGGGCCGTAAACTTCATTAGGACCCTGGGAAACTTGCG</p>
<p>AGTATTTGGTATATTATTAGACCGAATACCTTTATTTGCCTGAGCTGTTCTTATTACTGC</p>
<p>TGTTCTCCTTCTCCTGTCTTTACCGGTATTAGCTGGAGCTATTACAATATTGTTAACAGA</p>
<p>TCGTAACCTAAATACTTCTTTCTATGATGTTGGGGGGGGCGGTGACCCTATTCTATACCA</p>
<p>GCATCTA</p>
<p>The proportion of the two lineages was estimated from the relative counts of each OTU.<br />
<br />
<strong>Cruise identifiers and Sampling dates:</strong><br />
This list includes cruise identifiers also entered in the&nbsp;"Deployments" section of this&nbsp;metadata page as well as description of additional small boat deployments without formal cruise identifiers.</p>
<p>TXS15, Russell Hopcroft, 5/10/15 - 5/11/15<br />
TXF15, Russell Hopcroft, 9/13/15 - 9/20/15<br />
TXS16, Russell Hopcroft, 4/29/16 - 5/6/16<br />
TXS16, Russell Hopcroft, 4/29/16 - 5/6/16<br />
TXF16, Russell Hopcroft, 9/15/16 - 9/20/16<br />
TXS17, Russell Hopcroft, 5/3/17 - 5/9/17<br />
TXF17, Russell Hopcroft, 9/15/17 - 9/22/17<br />
SKQ201810S, Russell Hopcroft, 4/17/18 - 5/6/18<br />
TGX201809, Russell Hopcroft, 9/11/18 - 9/25/18<br />
TGX201904, Russell Hopcroft, 4/26/19 - 5/9/19<br />
SKQ201916S, Russell Hopcroft, 7/21/19 – 8/3/19<br />
TGX201909, Russell Hopcroft, 9/10/19 - 9/26/19<br />
SKQ202006S, Russell Hopcroft, 5/3/20 -5/10/20<br />
SKQ202106S, Russell Hopcroft, 4/19/21 -5/7/21<br />
TGX202109, Russell Hopcroft, 9/10/21 - 9/27/21<br />
SKQ202207S, Ana Aguilar Islas, 4/19/22 - 5/8/22<br />
Day-trips aboard the M/V Dora 4/15/2019 to GAK1 and the R/V Nanuq in Resurrection Bay, AK between January and March, 2023<br />
NOAA Ocean Exploration, Gulf of Alaska Seamounts 2019, Russell Hopcroft, 7/21/2019 – 8/3/2019</p>
Funding provided by NSF Office of Polar Programs (formerly NSF PLR) (NSF OPP) Award Number: OCE-2222376 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=2222376
Funding provided by NSF Office of Polar Programs (formerly NSF PLR) (NSF OPP) Award Number: OCE-2222592 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=2222592
Funding provided by NSF Office of Polar Programs (formerly NSF PLR) (NSF OPP) Award Number: OCE-2222558 Award URL: https://www.nsf.gov/awardsearch/show-award?AWD_ID=2222558
completed
Petra H. Lenz
University of Hawaiʻi at Mānoa
808-956-8003
Pacific Biosciences Research Center (PBRC), Bekesy Laboratory of Neurobiology 1993 East-West Road
Honolulu
HI
96822
United States
petra@hawaii.edu
pointOfContact
Daniel K. Hartline
University of Hawaiʻi at Mānoa
808-956-8003
Pacific Biosciences Research Center 1993 East-West Rd.
Honolulu
HI
96822
USA
danh@pbrc.hawaii.edu
pointOfContact
Vittoria Roncalli
University of Hawaiʻi at Mānoa
Bekesy Laboratory of Neurobiology and Zoology Dept. 1993 East-West Road
Honolulu
Hawaii
96822
roncalli@hawaii.edu
pointOfContact
asNeeded
Dataset Version: 1
Unknown
Year
Stage
SRX
Nf_Small
Nf_Large
Np
Nc
Cg
Eb
Mp
BioProject
Illumina MiSeq
Illumina Next-Seq 500
General Oceanics flowmeters
Dissecting microscope, Leica MZ16 and Olympus SZN
Midi Multinet, Hydro-Bios
General Oceanics messenger with double trip mechanism
Elongated QuadNet
theme
None, User defined
year
stage
NCBI SRA experiment accession (SRX)
count
NCBI BioProject accession
featureType
BCO-DMO Standard Parameters
Automated DNA Sequencer
Automated DNA Sequencer
Bongo Net
Flow Meter
Folsom Plankton Splitter
Microscope - Optical
MultiNet
no_bcodmo_term
Plankton Net
instrument
BCO-DMO Standard Instruments
TXS15
TXF15
TXS16
TXF16
TXS17
TXF17
SKQ201810S
TXF18
TXS19
SKQ201916S
TXF19
SKQ202006S
SKQ202106S
TXF21
SKQ202207S
service
Deployment Activity
Northern Gulf of Alaska
Gulf of Alaska
place
Locations
otherRestrictions
otherRestrictions
Access Constraints: none. Use Constraints: Please follow guidelines at: http://www.bco-dmo.org/terms-use Distribution liability: Under no circumstances shall BCO-DMO be liable for any direct, incidental, special, consequential, indirect, or punitive damages that result from the use of, or the inability to use, the materials in this data submission. If you are dissatisfied with any materials in this data submission your sole and exclusive remedy is to discontinue use.
Collaborative Research: Zooplankton restarts in a high-latitude marine ecosystem: species-specific recruitment and development in early spring
https://osprey.bco-dmo.org/project/908803
Collaborative Research: Zooplankton restarts in a high-latitude marine ecosystem: species-specific recruitment and development in early spring
<p><strong>NSF Award Abstract</strong><br />
Global climate change and associated extreme weather events are increasingly impacting marine communities at all trophic levels and leading to shifts in the timing of life history events. This project is investigating the annual restart of the spring zooplankton community in the Gulf of Alaska in order to determine the timing of species-specific recruitment and growth. Zooplankton are small pelagic animals that are a critical link between microalgae and protozoans and higher levels in the food web including economically important fishes, birds and marine mammals. While their abundances and species composition have been documented over part of the annual cycle between late spring and fall, this project focuses on winter and early spring. The project integrates traditional methods with modern molecular approaches to characterize the diversity, development, feeding and physiology of zooplankton, especially the early developmental stages of copepods (small crustaceans). The goal is to determine which species are there, how many are present and where they are in the water column, and to reveal indicators of their health. Broader impacts include research training for three graduate students and at least four undergraduates in biological oceanography and physiological ecology. Outreach activities are focusing on broadening the public’s understanding of plankton ecology. An illustrated zooplankton guide for the Gulf of Alaska and plankton module for school teachers and students is being produced in collaboration with the Center for Alaskan Coastal Studies. Other plans include sponsorship of nature-drawing workshops on zooplankton and the production of an Art & Science traveling exhibit.</p>
<p>This project is tracking zooplankton population abundances, species composition and developmental stages through the spring restart in a high-latitude fjord in the northern Gulf of Alaska. While the entire zooplankton community is being characterized, the main focus is on the difficult-to-assess early developmental stages of copepods, which dominate the late spring biomass in the region. Three central hypotheses guide the research: 1) high abundances of copepod nauplii are present before any measurable increases in food in surface waters; 2) species diversity increases between winter and spring, with nauplii from large lipid-rich capital-breeding species appearing first, followed by those from income- and hybrid-strategy species and finally nauplii that emerge from dormant eggs; 3) prior to the appearance of food resources, nauplii from capital-breeding species conserve resources by delaying development and entering a state of dormancy in the second and third naupliar stages. The project entails intensive depth-stratified field sampling to characterize the wild community, in combination with laboratory experiments on nauplii to determine their responsiveness to food. The prey are being characterized by measuring chlorophyll a, dietary and prey community DNA sequencing and flow cytometry to establish diversity and abundances. Size-fractionated zooplankton samples are being analyzed using microscopy and community DNA sequencing to ascertain species diversity, developmental stage distribution and abundances. Feeding activity is being measured using dietary DNA sequencing of nauplii followed by comparisons with the prey field. Dormancy in nauplii is being determined by differential gene expression of target genes (RT-qPCR) and high-throughput sequencing of mRNA of individuals (transcriptomics) and community samples (meta-transcriptomics). Short-term and long-term effects of food availability on dormancy, development and growth are being quantified in laboratory experiments. Broader impacts are focused on training of students in interdisciplinary research and state-of-art techniques, and public outreach to introduce plankton ecology to broader audiences.</p>
Zooplankton recruitment
largerWorkCitation
project
eng; USA
oceans
Northern Gulf of Alaska; Gulf of Alaska
-149.4838
-145.4238
56.2321
59.8443
2015-05-01
2023-03-24
Sub-arctic marine ecosystem, Gulf of Alaska
0
BCO-DMO catalogue of parameters from Molecular identification of genetic variants of Neocalanus flemingeri in the Gulf of Alaska from samples collected from 2015 to 2023
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
http://lod.bco-dmo.org/id/dataset-parameter/958671.rdf
Name: Year
Units: unitless
Description: <p>Sample collection year</p>
http://lod.bco-dmo.org/id/dataset-parameter/958672.rdf
Name: Stage
Units: unitless
Description: <p>Developmental stage: pre-adult copepodite stage CV or adult female</p>
http://lod.bco-dmo.org/id/dataset-parameter/958673.rdf
Name: SRX
Units: unitless
Description: <p>NCBI SRX (SRA experiment) accession number of individual's reads file used for Bowtie mapping</p>
http://lod.bco-dmo.org/id/dataset-parameter/958674.rdf
Name: Nf_Small
Units: count
Description: <p>Neocalanus flemingeri (urn:lsid:marinespecies.org:taxname:353708) small form</p>
http://lod.bco-dmo.org/id/dataset-parameter/958675.rdf
Name: Nf_Large
Units: count
Description: <p>Neocalanus flemingeri (urn:lsid:marinespecies.org:taxname:353708) large form</p>
http://lod.bco-dmo.org/id/dataset-parameter/958676.rdf
Name: Np
Units: count
Description: <p>Neocalanus plumchrus (urn:lsid:marinespecies.org:taxname:196772)</p>
http://lod.bco-dmo.org/id/dataset-parameter/958677.rdf
Name: Nc
Units: count
Description: <p>Neocalanus cristatus (urn:lsid:marinespecies.org:taxname:104470)</p>
http://lod.bco-dmo.org/id/dataset-parameter/958678.rdf
Name: Cg
Units: count
Description: <p>Calanus glacialis (urn:lsid:marinespecies.org:taxname:104465) / Calanus marshallae (urn:lsid:marinespecies.org:taxname:196770)</p>
http://lod.bco-dmo.org/id/dataset-parameter/958679.rdf
Name: Eb
Units: count
Description: <p>Eucalanus bungii (urn:lsid:marinespecies.org:taxname:196775)</p>
http://lod.bco-dmo.org/id/dataset-parameter/958680.rdf
Name: Mp
Units: count
Description: <p>Metridia pacifica (urn:lsid:marinespecies.org:taxname:196784)</p>
http://lod.bco-dmo.org/id/dataset-parameter/958681.rdf
Name: BioProject
Units: unitless
Description: <p>NCBI BioProject containing the SRX set</p>
GB/NERC/BODC > British Oceanographic Data Centre, Natural Environment Research Council, United Kingdom
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
20165
https://darchive.mblwhoilibrary.org/server/api/core/bitstreams/a52f3419-af05-4fda-9564-ff1b99eb0b27/content
download
https://doi.org/10.26008/1912/bco-dmo.954181.1
download
onLine
dataset
<p><strong>Collections and sample preservation</strong></p>
<p>Collections during the spring and fall were made during oceanographic cruises of the Seward Line Long-term Observation Program (LTOP) and northern Gulf of Alaska Long Term Ecological Research programs (https://nga.lternet.edu/) between 2015 and 2022. Additional samples were collected at nearshore stations (GAK1 and RES2.5) in 2019 and 2023, and in 2019 in the Gulf of Alaska Seamount region from below 1000 m (see map, Supplemental File "collections_regional_map.png").</p>
<p><strong>RNA-Seq Data</strong></p>
<p>Pre-adult <em>Neocalanus flemingeri</em> stage CV were collected from the upper 100 m in April and May from 5 to 6 stations. Upon retrieval of the net (QuadNet, 53 µm mesh), the plankton collection was live sorted under the microscope and preserved in RNALater. In 2019, <em>N.</em> <em>flemingeri</em> were collected in mid-April for an incubation experiment with individuals maintained in the laboratory for up to 2 months before preservation for RNA-Seq (Roncalli et al., 2023). In September, samples were collected from depth (300 to 700 m) using a 0.25 m<sup>2</sup> Multinet (Hydrobios), live sorted and preserved for RNA-Seq immediately or after laboratory incubation. Fall collections were primarily from Prince William Sound (stations PWS2 and KIP2) with the exception of July 2019, when adult females were collected from depth (&gt;1000 m) in the Gulf of Alaska (stations GAK19 and “Quinn deep”).</p>
<p>Sample processing (RNA extraction, library preparation and high-throughput sequencing) has been described previously (Roncalli et al., 2018, 2019, 2021). Paired-end sequencing was done on the Illumina Platform (NextSeq) and short-sequence read lengths were set to either 75 or 150 bp with sequencing depth of 10M or greater. Raw sequence data are available through National Center for Biotechnology Information with additional metadata available through BCO-DMO datasets ids 922330 and&nbsp;914459&nbsp;(Lenz et al., 2024). Raw sequence data were quality checked, sequences with phred scores below 30 were removed, and sequences were trimmed to remove adapters and the first 9 bp (Roncalli et al., 2018). In addition, rRNA transcripts were removed using SortMeRNA (version 4.2.0) (Kopylova et al., 2012). Lineage identification was based on cytochrome <em>c</em> oxidase subunit-1 (mtCOI) reference sequences that were used to establish the sequence differences between the two forms (Machida and Tsuda, 2010). For the RNA-Seq data, a mtCOI reference database was generated using full length sequences for small-form and large-form&nbsp; <em>N. flemingeri</em>, as well as <em>N. plumchrus</em>, <em>N. cristatus</em>, <em>Calanus marshallae</em>, <em>Eucalanus bungii</em> and <em>Metridia pacific </em>(see Supplemental File "species_list_copepods.csv" for additional copepod species name information and taxonomic identifiers). The reference consisted of consensus sequences obtained by comparing sequences downloaded from NCBI and from <em>de novo</em> assemblies (Hartline et al., 2023; Hartline et al.,&nbsp;2024 [BCO-DMO dataset 908689] ). RNA-Seq libraries from each individual were mapped against the mtCOI reference using Bowtie2 (version 2.3.5.1, default options in paired end mode) as described previously for an approach that was originally developed to identify and quantify <em>Calanus</em> congeners in RNA-Seq data (Lenz et al., 2021a,b). Since mtCOI mapping is highly specific, this approach successfully distinguishes between closely related species and genetic lineages.&nbsp; Cross-mapping is minimal, and even between the two <em>N. flemingeri</em> lineages is typically below 2% (maximum 7%). Data analysis involved tallying the number of individuals that mapped to each lineage for each station/year collection. Analysis for spatial and temporal patterns of the number of small vs large form individuals was done by combining data by year from multiple locations, and by combining regional data for both pre-adult and adult individuals to examine interannual differences.</p>
<p><strong>DNA Sequencing</strong></p>
<p>In 2016, additional individuals were collected during the spring and fall cruises for DNA extraction (n=123), amplification of the mtCOI and Sanger sequencing. Individual <em>N. flemingeri </em>were preserved in RNALater prior to DNA extraction using the DNEasy Blood and&nbsp;Tissue Kit (Qiagen). Extracted DNA was amplified using universal DNA primers, LCO1490 and&nbsp;HCO2198, which consistently amplify a 710-bp region of the mitochondrial cytochrome oxidase subunit I gene from a variety of metazoan invertebrates (Folmer et al, 1994). PCR products were checked for expected size using gel electrophoresis, and purified using Qiagen`s Purification Kit prior to Sanger sequencing at the Advanced Studies in Genomics, Proteomics and Bioinformatics (ASGPB) at the University of Hawai‘i at Mānoa. Sequence data were edited for quality using Geneious and searched on NCBI for the closest match using BLAST (Altschul et al., 1990). Top <em>N. flemingeri</em> hits were compared to published lineage-specific sequences (Machida and Tsuda, 2010) for small form vs. large form identification.</p>
<p><strong>Metabarcoding</strong></p>
<p>DNA metabarcoding of bulk samples containing nauplii of <em>N. flemingeri</em> were collected in Resurrection Bay between January and March, 2023, size fractionated and preserved in ethanol (Block, 2024). The small size-fraction of the bulk samples (53 – 210 µm fraction) were extracted for DNA using the Qiagen DNeasy Blood and Tissue Mini Kit with an extended 24-hour proteinase K incubation to ensure adequate lysis. The mtCOI was amplified using the mlCOIintF and jgHCO2198 primers (Leray et al., 2013), sequenced and processed using established pipelines as described elsewhere (Block, 2024). Amplicon sequences were quantified, clustered and identified to lineage using reference sequences downloaded from the MetaZooGene database (Bucklin et al., 2021).&nbsp;The full MZGdb (downloaded July 14, 2023), included global sequences of marine invertebrates, vertebrates, and microbes (https://metazoogene.org/, MetaZooGene &amp; O'Brien, T.&nbsp; (2023)).&nbsp;The two <em>N. flemingeri</em> genetic lineages were represented by two distinct operational taxonomic units (OTUs) that differed by ca. 3%. 10 diagnostic base pairs out of 307 are indicated by the highlighting in the fasta sequences:</p>
<p>&gt;Nf1_Neocalanus flemingeri OTU 1 (small form)</p>
<p>GTCTAGAAATATTGCCCATGCGGGAGGTTCTGTAGACTTCGCTATTTTCTCACTTCATTT</p>
<p>AGCAGGTGTGAGATCTATTTTAGGGGCCGTAAACTTCATTAGAACCCTCGGAAACTTACG</p>
<p>AGTATTTGGTATATTATTAGACCGAATACCTTTATTTGCCTGAGCTGTTCTTATTACTGC</p>
<p>TGTTCTCCTTCTCCTGTCTTTACCAGTATTAGCTGGAGCTATTACAATATTGTTAACAGA</p>
<p>TCGTAACCTAAATACTTCTTTTTATGATGTTGGCGGGGGCGGTGACCCTATTCTGTACCA</p>
<p>GCATCTA</p>
<p>&nbsp;</p>
<p>&gt;Nf2_Neocalanus flemingeri OTU2 (large form)</p>
<p>CTCTAGAAATATTGCCCATGCGGGAGGTTCTGTAGACTTCGCTATTTTCTCACTTCACTT</p>
<p>GGCAGGTGTGAGATCTATTTTAGGGGCCGTAAACTTCATTAGGACCCTGGGAAACTTGCG</p>
<p>AGTATTTGGTATATTATTAGACCGAATACCTTTATTTGCCTGAGCTGTTCTTATTACTGC</p>
<p>TGTTCTCCTTCTCCTGTCTTTACCGGTATTAGCTGGAGCTATTACAATATTGTTAACAGA</p>
<p>TCGTAACCTAAATACTTCTTTCTATGATGTTGGGGGGGGCGGTGACCCTATTCTATACCA</p>
<p>GCATCTA</p>
<p>The proportion of the two lineages was estimated from the relative counts of each OTU.<br />
<br />
<strong>Cruise identifiers and Sampling dates:</strong><br />
This list includes cruise identifiers also entered in the&nbsp;"Deployments" section of this&nbsp;metadata page as well as description of additional small boat deployments without formal cruise identifiers.</p>
<p>TXS15, Russell Hopcroft, 5/10/15 - 5/11/15<br />
TXF15, Russell Hopcroft, 9/13/15 - 9/20/15<br />
TXS16, Russell Hopcroft, 4/29/16 - 5/6/16<br />
TXS16, Russell Hopcroft, 4/29/16 - 5/6/16<br />
TXF16, Russell Hopcroft, 9/15/16 - 9/20/16<br />
TXS17, Russell Hopcroft, 5/3/17 - 5/9/17<br />
TXF17, Russell Hopcroft, 9/15/17 - 9/22/17<br />
SKQ201810S, Russell Hopcroft, 4/17/18 - 5/6/18<br />
TGX201809, Russell Hopcroft, 9/11/18 - 9/25/18<br />
TGX201904, Russell Hopcroft, 4/26/19 - 5/9/19<br />
SKQ201916S, Russell Hopcroft, 7/21/19 – 8/3/19<br />
TGX201909, Russell Hopcroft, 9/10/19 - 9/26/19<br />
SKQ202006S, Russell Hopcroft, 5/3/20 -5/10/20<br />
SKQ202106S, Russell Hopcroft, 4/19/21 -5/7/21<br />
TGX202109, Russell Hopcroft, 9/10/21 - 9/27/21<br />
SKQ202207S, Ana Aguilar Islas, 4/19/22 - 5/8/22<br />
Day-trips aboard the M/V Dora 4/15/2019 to GAK1 and the R/V Nanuq in Resurrection Bay, AK between January and March, 2023<br />
NOAA Ocean Exploration, Gulf of Alaska Seamounts 2019, Russell Hopcroft, 7/21/2019 – 8/3/2019</p>
Specified by the Principal Investigator(s)
<p>The presence and relative occurrence of the two genetic variants were based on differences in the cytochrome <em>c</em> oxidase subunit-1 sequence (mtCOI) (Machida &amp; Tsuda 2010, Lenz et al. 2021). A mtCOI reference database was generated from the unique sequences for the two variants as well as from those of other common copepod species from the Gulf of Alaska (Hartline et al. 2023). To distinguish between the genetic variants, short-read RNA-Seq data from live-sorted <em>N. flemingeri</em> were mapped against this mtCOI reference (Bowtie2, vs. 2.3.5.1). The variant (or species) receiving the most mapped reads, usually in great excess, was taken as the individual's identity. This was also used to identify and remove individuals that had been misidentified in the original morphological-based sorting.</p>
Specified by the Principal Investigator(s)
* Submitted files were imported into the BCO-DMO data system for this dataset:
CopepodSpeciesFilter.csv (will appear in this dataset as Data File: 954181_v1_copepod_species_filter.csv)
Bowtie-Mapping results.csv (will appear in this dataset as Data File: 954181_v1_bowtie-mapping-results.csv)
Suitos-BLAST-data.csv (will appear in this dataset as Data File: 954181_v1_suitos-blast-data.csv)
* submitter noted that the bowtie-mapping results 954181_v1_bowtie-mapping-results.csv were to be considered the primary data table of this dataset. As such all other tables were attached as supplemental files.
* Column names adjusted to conform to BCO-DMO naming conventions designed to support broad re-use by a variety of research tools and scripting languages. [Only numbers, letters, and underscores. Can not start with a number]
* Non-standard whitespace characters replaced with standard space character.
* Character Ü was removed for values in COI_location and Notes columns of this dataset. Data provided that was for internal use and could be removed from the published dataset.
* Unique species names extracted from "CopepodSpeciesFilter.csv" and matched to identifiers at World Register of Marine Species (WoRMS, marinespecies.org on 2025-02-27). ScientificName and Life Science Identifer (LSID) column added for the identifiers for the species names used within "Species" categories in this table. Supplemental file for copepod species list added.
* Species names in the column descriptions for 954181_v1_bowtie-mapping-results.csv (Parameters section) were updated with the correct spelling of the currently accepted names.
* Additional supplemental file added with combined information from all SRA Run tables from all three associated NCBI BioProjects which includes SRA run, experiment, and BioSample collection metadata. This was added as Supplemental File: 954181_v1_sra-run-table.csv
* lat_lon field split into lat, lon columns and standardized to decimal degree format for geospatial research-ready capability. No lat_lon was provided for samples in BioProject PRJNA496596, PRJNA807352, PRJNA662858, and some were missing in PRJNA324453. The data submitter noted that the lat lons are available two BCO-DMO datasets. These datasets were added to the "Related Datasets" section of this page for easier discoverability:
Dataset (922330)
Multiyear RNA-Seq of Neocalanus flemingeri stages CV and Adult Female from the R/V Tiglax and R/V Sikuliaq in the Northern Gulf of Alaska from 2015-2022.
BCO-DMO page: https://www.bco-dmo.org/dataset/922330
Dataset (914459):
Gene expression profiles for Neocalanus flemingeri pre adults (CV) exposed to four different experimental food conditions collected from the M/V Dora in the Gulf of Alaska at station GAK1 from April 2019
BCO-DMO page: https://www.bco-dmo.org/dataset/914459
* Several columns in sra_run table were not able to be typed as numerc such as depth (due to some being ranges in single value) and temp which included String units in the values.
* The citation in metadata on this dataset "(see map, SupplementS2)" was replaced with "(see map, Supplemental File "collections_regional_map.png")" since the submitter supplied this map. The supplementS2 reference was explained as a reference to a manuscript under review.
* Invalid sampling date in metadata text "TXS15, Russell Hopcroft, 5/103/15 - 5/11/15" changed to "5/10/15 - 5/11/15" as cruise dates were only between "05-05-2015 to 05-11-2015"
Specified by BCO-DMO Data Managers
asNeeded
7.x-1.1
Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Unavailable
508-289-2009
WHOI MS#36
Woods Hole
MA
02543
USA
info@bco-dmo.org
http://www.bco-dmo.org
Monday - Friday 8:00am - 5:00pm
For questions regarding this resource, please contact BCO-DMO via the email address provided.
pointOfContact
Illumina MiSeq
Illumina MiSeq
PI Supplied Instrument Name: Illumina MiSeq Instrument Name: Automated DNA Sequencer Instrument Short Name:Automated Sequencer Instrument Description: A DNA sequencer is an instrument that determines the order of deoxynucleotides in deoxyribonucleic acid sequences.
Illumina Next-Seq 500
Illumina Next-Seq 500
PI Supplied Instrument Name: Illumina Next-Seq 500 Instrument Name: Automated DNA Sequencer Instrument Short Name:Automated Sequencer Instrument Description: A DNA sequencer is an instrument that determines the order of deoxynucleotides in deoxyribonucleic acid sequences.
PI Supplied Instrument Name: PI Supplied Instrument Description:Bongo Nets, 30-cm diameter equipped with 53-μm mesh nets Instrument Name: Bongo Net Instrument Short Name:Bongo Net Instrument Description: A Bongo Net consists of paired plankton nets, typically with a 60 cm diameter mouth opening and varying mesh sizes, 10 to 1000 micron. The Bongo Frame was designed by the National Marine Fisheries Service for use in the MARMAP program. It consists of two cylindrical collars connected with a yoke so that replicate samples are collected at the same time. Variations in models are designed for either vertical hauls (OI-2500 = NMFS Pairovet-Style, MARMAP Bongo, CalVET) or both oblique and vertical hauls (Aquatic Research). The OI-1200 has an opening and closing mechanism that allows discrete "known-depth" sampling. This model is large enough to filter water at the rate of 47.5 m3/minute when towing at a speed of two knots. More information: Ocean Instruments, Aquatic Research, Sea-Gear Community Standard Description: http://vocab.nerc.ac.uk/collection/L22/current/NETT0009/
General Oceanics flowmeters
General Oceanics flowmeters
PI Supplied Instrument Name: General Oceanics flowmeters Instrument Name: Flow Meter Instrument Short Name:Flow Meter Instrument Description: General term for a sensor that quantifies the rate at which fluids (e.g. water or air) pass through sensor packages, instruments, or sampling devices. A flow meter may be mechanical, optical, electromagnetic, etc. Community Standard Description: http://vocab.nerc.ac.uk/collection/L05/current/388/
PI Supplied Instrument Name: Instrument Name: Folsom Plankton Splitter Instrument Short Name:Folsom Splitter Instrument Description: A device for sub-sampling of plankton and ichthyoplankton samples by splitting, developed by Dr. Folsom of the Scripps Institute of Oceanography. Ideally suited for splitting plankton samples with minimal debris. A measured volume of plankton sample is placed in the undivided section of the drum. This is rotated 120 degrees to divide the stirred sample with a separating blade. Standard Methods suggests splitting until a subsample of 200-500 individuals is obtained.
Dissecting microscope, Leica MZ16 and Olympus SZN
Dissecting microscope, Leica MZ16 and Olympus SZN
PI Supplied Instrument Name: Dissecting microscope, Leica MZ16 and Olympus SZN Instrument Name: Microscope - Optical Instrument Short Name: Instrument Description: Instruments that generate enlarged images of samples using the phenomena of reflection and absorption of visible light. Includes conventional and inverted instruments. Also called a "light microscope". Community Standard Description: http://vocab.nerc.ac.uk/collection/L05/current/LAB05/
Midi Multinet, Hydro-Bios
Midi Multinet, Hydro-Bios
PI Supplied Instrument Name: Midi Multinet, Hydro-Bios PI Supplied Instrument Description:Midi Multinet, Hydro-Bios (0.5 m2 cross-sectional area; 150 μm mesh nets) Instrument Name: MultiNet Instrument Short Name:MultiNet Instrument Description: The MultiNet© Multiple Plankton Sampler is designed as a sampling system for horizontal and vertical collections in successive water layers. Equipped with 5 or 9 net bags, the MultiNet© can be delivered in 3 sizes (apertures) : Mini (0.125 m2), Midi (0.25 m2) and Maxi (0.5 m2). The system consists of a shipboard Deck Command Unit and a stainless steel frame to which 5 (or 9) net bags are attached by means of zippers to canvas. The net bags are opened and closed by means of an arrangement of levers that are triggered by a battery powered Motor Unit. The commands for actuation of the net bags are given via single or multi-conductor cable between the Underwater Unit and the Deck Command Unit. Although horizontal collections typically use a mesh size of 300 microns, mesh sizes from 100 to 500 may also be used. Vertical collections are also common. The shipboard Deck Command Unit displays all relevant system data, including the actual operating depth of the net system. Community Standard Description: http://vocab.nerc.ac.uk/collection/L22/current/NETT0099/
General Oceanics messenger with double trip mechanism
General Oceanics messenger with double trip mechanism
PI Supplied Instrument Name: General Oceanics messenger with double trip mechanism Instrument Name: no_bcodmo_term Instrument Short Name: Instrument Description: No relevant match in BCO-DMO instrument vocabulary. Community Standard Description: http://vocab.nerc.ac.uk/collection/L05/current/999/
Elongated QuadNet
Elongated QuadNet
PI Supplied Instrument Name: Elongated QuadNet PI Supplied Instrument Description:Elongated QuadNet net equipped with two 53-μm and two 150-μm mesh nets (25 cm diameter) Instrument Name: Plankton Net Instrument Short Name:Plankton Net Instrument Description: A Plankton Net is a generic term for a sampling net that is used to collect plankton. It is used only when detailed instrument documentation is not available. Community Standard Description: http://vocab.nerc.ac.uk/collection/L05/current/22/
Cruise: TXS15
TXS15
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXS15
Russell R. Hopcroft
https://www.ncei.noaa.gov/access/ocean-carbon-acidification-data-system/oceans/Coastal/seward.html
Report describing TXS15
Cruise: TXF15
TXF15
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXF15
Russell R. Hopcroft
University of Alaska Fairbanks
https://www.ncei.noaa.gov/access/ocean-carbon-acidification-data-system/oceans/Coastal/seward.html
Report describing TXF15
Cruise: TXS16
TXS16
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXS16
Russell R. Hopcroft
https://www.ncei.noaa.gov/access/ocean-carbon-acidification-data-system/oceans/Coastal/seward.html
Report describing TXS16
Cruise: TXF16
TXF16
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXF16
Russell R. Hopcroft
University of Alaska Fairbanks
https://www.ncei.noaa.gov/access/ocean-carbon-acidification-data-system/oceans/Coastal/seward.html
Report describing TXF16
Cruise: TXS17
TXS17
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXS17
Russell R. Hopcroft
https://www.ncei.noaa.gov/access/ocean-carbon-acidification-data-system/oceans/Coastal/seward.html
Report describing TXS17
Cruise: TXF17
TXF17
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXF17
Russell R. Hopcroft
University of Alaska Fairbanks
https://www.ncei.noaa.gov/access/ocean-carbon-acidification-data-system/oceans/Coastal/seward.html
Report describing TXF17
Cruise: SKQ201810S
SKQ201810S
R/V Sikuliaq
Community Standard Description
International Council for the Exploration of the Sea
R/V Sikuliaq
vessel
SKQ201810S
Russell R. Hopcroft
https://nga.lternet.edu/wp-content/uploads/2019/04/Cruise-Report-SKQ201810S.pdf
Report describing SKQ201810S
Cruise: TXF18
TXF18
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXF18
Russell R. Hopcroft
University of Alaska Fairbanks
https://nga.lternet.edu/wp-content/uploads/2019/04/Cruise-Report-TXF18.pdf
Report describing TXF18
Cruise: TXS19
TXS19
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXS19
Russell R. Hopcroft
University of Alaska Fairbanks
https://nga.lternet.edu/wp-content/uploads/2019/10/Cruise-Report-TXS19.pdf
Report describing TXS19
Cruise: SKQ201916S
SKQ201916S
R/V Sikuliaq
Community Standard Description
International Council for the Exploration of the Sea
R/V Sikuliaq
vessel
SKQ201916S
Russell R. Hopcroft
Cruise: TXF19
TXF19
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXF19
Russell R. Hopcroft
University of Alaska Fairbanks
https://nga.lternet.edu/wp-content/uploads/2020/02/Cruise-Report-TXF19.pdf
Report describing TXF19
Cruise: SKQ202006S
SKQ202006S
R/V Sikuliaq
Community Standard Description
International Council for the Exploration of the Sea
R/V Sikuliaq
vessel
SKQ202006S
Russell R. Hopcroft
https://nga.lternet.edu/wp-content/uploads/2020/07/Cruise-Report-SKQ202006S_v2.pdf
Report describing SKQ202006S
Cruise: SKQ202106S
SKQ202106S
R/V Sikuliaq
Community Standard Description
International Council for the Exploration of the Sea
R/V Sikuliaq
vessel
SKQ202106S
Russell R. Hopcroft
Cruise: TXF21
TXF21
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
TXF21
Russell R. Hopcroft
https://nga.lternet.edu/wp-content/uploads/2022/03/Cruise-Report-TGX202109.pdf
Report describing TXF21
Cruise: SKQ202207S
SKQ202207S
R/V Sikuliaq
Community Standard Description
International Council for the Exploration of the Sea
R/V Sikuliaq
vessel
SKQ202207S
Russell R. Hopcroft
R/V Tiglax
Community Standard Description
International Council for the Exploration of the Sea
R/V Tiglax
vessel
R/V Sikuliaq
Community Standard Description
International Council for the Exploration of the Sea
R/V Sikuliaq
vessel