| Contributors | Affiliation | Role |
|---|---|---|
| Hughes, A. Randall | Northeastern University | Principal Investigator |
| DuBois, Katherine | University of California-Davis (UC Davis) | Scientist |
| Kardish, Melissa | University of California-Davis (UC Davis) | Scientist |
| Schenck, Forest | Northeastern University | Scientist |
| Stachowicz, Jay | University of California-Davis (UC Davis) | Scientist |
| York, Amber D. | Woods Hole Oceanographic Institution (WHOI BCO-DMO) | BCO-DMO Data Manager |
We used a substitutive design to test the effects of eelgrass (Zostera marina) genotypic identity (eight genotypes), diversity (monocultures of 1 genotype vs. polycultures of 4 genotypes), and temperature (ambient or + 3.2° C) on the prevalence and intensity of Labyrinthula over eight weeks (July – September) in an array of flow-through 120-L mesocosms at the Bodega Marine Laboratory in Bodega Bay, CA. At the end of the experiment we collected and preserved the top half of the focal leaf in individual plastic bags sealed with 30 ml of silica (Flower Drying Art Silica Gel; Activa) for subsequent DNA extraction and quantitative PCR to estimate Labyrinthula zosterae cells as a proxy for infection (Bergmann et al. 2011, Bockelmann et al. 2013, Groner et al. 2021).
We extracted L. zosterae DNA from dried leaf tissue using Omega Bio-Tek E.Z. Tissue DNA extraction kits at the Northeastern University Marine Science Center in Nahant, MA. For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany) at a frequency of 30 Hz for 5 min (Bockelmann et al. 2013). We lysed ground subsamples individually following the manufacturer’s instructions and added 1 uL of 500 ng*uL-1 salmon sperm DNA solution (Invitrogen, USA) to the first subsample of each sample immediately before recombining all subsamples in the spin columns. Salmon sperm DNA was added to enhance extraction efficiency and ensure that even low amounts of target DNA are carried through the filter absorption steps (Bockelmann et al. 2013). We eluted all DNA extractions into 100 uL. Following elution, we used Zymo OneStep-96 PCR Inhibitor Removal kits to clean 50 uL sub-samples of each DNA extraction following the manufacturers instructions. We stored cleaned DNA extractions at -20˚C prior to quantitative PCR.
We used a TaqMan quantitative PCR (qPCR) assay with a forward primer: TTGAACGTAACATT-CGACTTTCGT, reverse primer: ACGCATGAAGCGGTCTTCTT, and MBG probe: TGGACGAGTGTGTTTTG that carries the fluorescence label 6-Fam at the 5’ end and the dark quencher FHQ at the 3’ end (Bio-Rad, USA) developed specifically for L. zosterae (Bockelmann et al. 2013, Bergmann et al. 2011). We made up qPCR reactions to a 10 uL reaction volume using standard conditions recommended by the manufacturer: 5 uL SsoAdvancedTM Universal Probes Supermix 2x (Bio-Rad, USA), 1 uL template DNA, 0.4 uL 4:1 Primer:Probe Mix (final concentrations of 400 nM forward primer, 400 nM reverse primer, 100 nM probe), and 3.6 uL Milli-Q H2O (Thermofisher, USA). Reactions were run on a CFX96 Real-Time System (Bio-Rad, USA) using the following thermo-cycling program: 3 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C and 1 min at 60˚C. We tested all samples in duplicate and if replicates differed by greater than one cycle threshold (Ct) reactions were rerun in triplicate. We only used the data from reactions in analyses when replicates fell within one Ct. Our lowest detection was 1.76 copies per reaction or 0.15 cells per extraction.
We ran each 96-well plate of qPCR reactions with a set of nine standards: a dilution series of gBlock Gene Fragments (Integrated DNA Technologies, USA) designed based on the highly conserved sequence of the 5.8s ribosomal RNA gene of L. zosterae known as internal transcribed spacer 1 (ITS) targeted by the TaqMan qPCR assay; an L. zosterae cell standard consisting of a sample of DNA extracted from a know quantity of pathogenic L. zosterae cells; and an inhibition control consisting of a half volume of L. zosterae cell standard and a half volume of a haphazardly selected sample. We ran a total of 31 96-well plates of qPCR reactions with a mean efficiency of 97.4% ± 4.3 and R2 0.996 ± 0.004.
Specifically, we first converted Ct values to copy numbers as our g-block standard curve were in units of copy number. We then used the L. zosterae cell standard to determine the copy number per L. zosterae cell. Finally, we converted copy number to L. zosterae cells * mg dw-1. Copy numbers per cell in our reactions were 1227.58 ± 80.66 (mean ± SE).
We used a pure culture of the pathogenic L. zosterae isolate 316b provided by D. Martin in 2015 to make our L. zosterae cell standard (Martin et al. 2016; GenBank: KU559372.1). We cultured L. zosterae cells on serum seawater agar media (Muehlstein et al. 1991). We scraped cells from an actively growing edge of L. zosterae culture into serum seawater liquid media (D. Martin pers. com.). We mixed the liquid media-L. zosterae cell slurry vigorously on a bench top vortex for 30 sec and aliquoted immediately into three replicate subsamples for cell counts and extraction. In order to break up cell clumps for ease of counting, we added Tween80 (Sigma-Aldrich, USA) to a final concentration of 1:100 into the two subsamples used for cell counts, and mixed for 30 sec. We counted cells of four replicate aliquots per subsample on a hemocytometer. We calculated cell concentration by averaging over all replicates. Prior to DNA extraction, we centrifuged the third replicate L. zosterae cell solution at 6,000 g for 10 min and drew off the supernatant without disturbing the cell pellet. We then added a ~4 mg section of dried healthy Z. marina tissue to the cell pellet to account for possible interference of Z. marina compounds in the extraction process. To extract L. zosterae DNA, we followed the DNA extraction and inhibitor removal protocols outlined above.
We designed the gBlock double stranded DNA fragments (Integrated DNA Technologies, USA) using published sequences of the ITS region of the L. zosterae genome (GenBank: JN121409-13).
5’-CTGTGATCTCTGAAAATACTTGTTT (1)TTGAACGTAACATTCGACTTTCGTCGATT TTG (2)TGGACGAGTGTGTTTTGT AAACCTACCC (3)AAGAAGACCGCTTCATGCGT GTCGCTGACTAATGAAACAAACAAA-3’
The gBlock fragment sequences were a total length of 130 bp, which included target regions for the forward (1) and reverse (3) primers and the MGD probe (2), underlined above, as well as 25 base pairs of additional sequence on both the 5’ and 3’ ends to increase fragment stability. We diluted gBlock fragments in Milli-Q H2O (Thermofisher, USA) to seven concentrations: 2.24e1, 1.12e2, 5.61e2, 2.81e3, 1.40e4, 7.02e4, 7.02e5 copies/µL and included this dilution series in each qPCR run as a standard curve (Bergmann et al. 2011). The range of the gBlock dilution curve: approx. 1-60,000 cells/extraction encompassed the range of most L. zosterae values observed in our samples: 0.15-450,000 cells/extraction or 1.84e2-5.52e8 copies/extraction.
Life Sciences Identifiers (LSID) for taxonomic names:
Zostera marina (urn:lsid:marinespecies.org:taxname:145795)
Labyrinthula zosterae (urn:lsid:marinespecies.org:taxname:395093)
Labyrinthula (urn:lsid:marinespecies.org:taxname:119090)
Code that includes quantitative PCR inhibition analysis associated with this experiment:
All code was written and run in R (version 3.6.1, www.R-project.org). Github repository https://github.com/schenckf/BWE_Experiment V2.0.0 archived at Zenodo (DOI: 10.5281/zenodo.7129500). A general description of the code is included in the repository release in file "Analysis Description.docx."
BCO-DMO Processing:
- Imported data from source file "mesocosm_warming_experiment_quantitativePCR_inhibition_control_data.csv" into the BCO-DMO data system. Data file imported using missing data identifier "NA".
- Modified parameter (column) names to conform with BCO-DMO naming conventions.
| File |
|---|
mesocosm_pcr.csv (Comma Separated Values (.csv), 1.16 KB) MD5:9a34116d2a6e4306f2de84d9dab6d741 Primary data file for dataset ID 883055 |
| Parameter | Description | Units |
| trial_no | Unique identifier number assigned to each of the 31 96-well plate quantitative PCR reactions | unitless |
| inhibition_sample_plate_id | Unique identifier alphanumeric code assigned to each of the nine Zostera marina tissue DNA extraction 96-well plates | unitless |
| inhibition_sample_well_id | Unique identifier alphanumeric code assigned to each well in each of the nine Zostera marina tissue DNA extraction 96-well plates | unitless |
| cells_uL_sample | The number of Labyrinthula zosterae cells detected by quantitative-PCR from DNA extracted from a tissue segment of the focal leaf of a Zostera marina plant per uL of DNA extraction solution | L. zosterae cells per microliter (cells/uL) |
| cells_uL_pos_cntrl | The number of Labyrinthula zosterae cells detected by quantitative-PCR from DNA extracted from a tissue segment of the focal leaf of cultured L. zosterae cells per uL of DNA extraction solution. (L. zosterae cells * uL-1). | L. zosterae cells per microliter (cells/uL) |
| cells_uL_inhibition | The number of Labyrinthula zosterae cells detected by quantitative-PCR from DNA extracted from tissue of the focal leaf of a Zostera marina plant combined with DNA extracted from cultured L. zosterae cells per uL of DNA extraction solution to test for inhibition. (L. zosterae cells * uL-1). | L. zosterae cells per microliter (cells/uL) |
| inhibition_cntrl_ID | Unique identifier associated with the culture of Labyrinthula zosterae cells used in each inhibition control trial. (L. zosterae cells * uL-1). | unitless |
| Dataset-specific Instrument Name | flow through tanks |
| Generic Instrument Name | Aquarium |
| Generic Instrument Description | Aquarium - a vivarium consisting of at least one transparent side in which water-dwelling plants or animals are kept |
| Dataset-specific Instrument Name | Retsch Mixer Mill 400 |
| Generic Instrument Name | Homogenizer |
| Dataset-specific Description | For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany) |
| Generic Instrument Description | A homogenizer is a piece of laboratory equipment used for the homogenization of various types of material, such as tissue, plant, food, soil, and many others. |
| Dataset-specific Instrument Name | Bio-Rad CFX96 Real-Time System |
| Generic Instrument Name | qPCR Thermal Cycler |
| Dataset-specific Description | The focal leaf was stored for subsequent DNA extraction and quantitative PCR to estimate Labyrinthula zosterae cells as a proxy for infection. Software: Bio-Rad CFX Manager Software (version 3.1) |
| Generic Instrument Description | An instrument for quantitative polymerase chain reaction (qPCR), also known as real-time polymerase chain reaction (Real-Time PCR). |
NSF Award Abstract:
Disease outbreaks in the ocean are increasing, causing losses of ecologically important marine species, but the factors contributing to these outbreaks are not well understood. This 5-year CAREER project will study disease prevalence and intensity in two marine foundation species - the seagrass Zostera marina and the Eastern oyster Crassostrea virginica. More specifically, host-disease relationships will be explored to understand how genetic diversity and population density of the host species impacts disease transmission and risk. This work will pair large-scale experimental restorations and smaller-scale field experiments to examine disease-host relationships across multiple spatial scales. Comparisons of patterns and mechanisms across the two coastal systems will provide an important first step towards identifying generalities in the diversity-density-disease relationship. To enhance the broader impacts and utility of this work, the experiments will be conducted in collaboration with restoration practitioners and guided by knowledge ascertained from key stakeholder groups. The project will support the development of an early career female researcher and multiple graduate and undergraduate students. Students will be trained in state-of-the-art molecular techniques to quantify oyster and seagrass parasites. Key findings from the surveys and experimental work will be incorporated into undergraduate courses focused on Conservation Biology, Marine Biology, and Disease Ecology. Finally, students in these courses will help develop social-ecological surveys and mutual learning games to stimulate knowledge transfer with stakeholders through a series of workshops.
The relationship between host genetic diversity and disease dynamics is complex. In some cases, known as a dilution effect, diversity reduces disease transmission and risk. However, the opposite relationship, known as the amplification effect, can also occur when diversity increases the risk of infection. Even if diversity directly reduces disease risk, simultaneous positive effects of diversity on host density could lead to amplification by increasing disease transmission between infected and uninfected individuals. Large-scale field restorations of seagrasses (Zostera marina) and oysters (Crassostrea virginica) will be utilized to test the effects of host genetic diversity on host population density and disease prevalence/intensity. Additional field experiments independently manipulating host genetic diversity and density will examine the mechanisms leading to dilution or amplification. Conducting similar manipulations in two marine foundation species - one a clonal plant and the other a non-clonal animal - will help identify commonalities in the diversity-density-disease relationship. Further, collaborations among project scientists, students, and stakeholders will enhance interdisciplinary training and help facilitate the exchange of information to improve management and restoration efforts. As part of these efforts, targeted surveys will be used to document the perceptions and attitudes of managers and restoration practitioners regarding genetic diversity and its role in ecological resilience and restoration.
| Funding Source | Award |
|---|---|
| NSF Division of Ocean Sciences (NSF OCE) |