| Data File(s) | Type | Description | Action |
|---|---|---|---|
mesocosm_pcr.csv (1.16 KB) | Comma Separated Values (.csv) | Primary data file for dataset ID 883055 |
Files
Type: Comma Separated Values (.csv)
Primary data file for dataset ID 883055
This data set includes quantitative PCR cell count estimates from samples of DNA extracted from seagrass wasting disease parasite, Labyrinthula zosterae, cultures of known cell concentrations run with and without DNA extracted from seagrass, Zostera marina, tissue samples to test for quantitative PCR signal inhibition. Seagrass tissue samples were collected as part of a mesocosm study at the Bodega Marine Laboratory examining the independent and interactive effects of warming, host genotypic ide...
Views
Downloads
These numbers come from web analytics and reflect real user activity on the site. Download counts include both page-based interactions and direct file downloads. They reliably show dataset usage and are mostly free of bot traffic.
We used a substitutive design to test the effects of eelgrass (Zostera marina) genotypic identity (eight genotypes), diversity (monocultures of 1 genotype vs. polycultures of 4 genotypes), and temperature (ambient or + 3.2° C) on the prevalence and intensity of Labyrinthula over eight weeks (July – September) in an array of flow-through 120-L mesocosms at the Bodega Marine Laboratory in Bodega Bay, CA. At the end of the experiment we collected and preserved the top half of the focal leaf in individual plastic bags sealed with 30 ml of silica (Flower Drying Art Silica Gel; Activa) for subsequent DNA extraction and quantitative PCR to estimate Labyrinthula zosterae cells as a proxy for infection (Bergmann et al. 2011, Bockelmann et al. 2013, Groner et al. 2021).
We extracted L. zosterae DNA from dried leaf tissue using Omega Bio-Tek E.Z. Tissue DNA extraction kits at the Northeastern University Marine Science Center in Nahant, MA. For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany) at a frequency of 30 Hz for 5 min (Bockelmann et al. 2013). We lysed ground subsamples individually following the manufacturer’s instructions and added 1 uL of 500 ng*uL-1 salmon sperm DNA solution (Invitrogen, USA) to the first subsample of each sample immediately before recombining all subsamples in the spin columns. Salmon sperm DNA was added to enhance extraction efficiency and ensure that even low amounts of target DNA are carried through the filter absorption steps (Bockelmann et al. 2013). We eluted all DNA extractions into 100 uL. Following elution, we used Zymo OneStep-96 PCR Inhibitor Removal kits to clean 50 uL sub-samples of each DNA extraction following the manufacturers instructions. We stored cleaned DNA extractions at -20˚C prior to quantitative PCR.
We used a TaqMan quantitative PCR (qPCR) assay with a forward primer: TTGAACGTAACATT-CGACTTTCGT, reverse primer: ACGCATGAAGCGGTCTTCTT, and MBG probe: TGGACGAGTGTGTTTTG that carries the fluorescence label 6-Fam at the 5’ end and the dark quencher FHQ at the 3’ end (Bio-Rad, USA) developed specifically for L. zosterae (Bockelmann et al. 2013, Bergmann et al. 2011). We made up qPCR reactions to a 10 uL reaction volume using standard conditions recommended by the manufacturer: 5 uL SsoAdvancedTM Universal Probes Supermix 2x (Bio-Rad, USA), 1 uL template DNA, 0.4 uL 4:1 Primer:Probe Mix (final concentrations of 400 nM forward primer, 400 nM reverse primer, 100 nM probe), and 3.6 uL Milli-Q H2O (Thermofisher, USA). Reactions were run on a CFX96 Real-Time System (Bio-Rad, USA) using the following thermo-cycling program: 3 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C and 1 min at 60˚C. We tested all samples in duplicate and if replicates differed by greater than one cycle threshold (Ct) reactions were rerun in triplicate. We only used the data from reactions in analyses when replicates fell within one Ct. Our lowest detection was 1.76 copies per reaction or 0.15 cells per extraction.
We ran each 96-well plate of qPCR reactions with a set of nine standards: a dilution series of gBlock Gene Fragments (Integrated DNA Technologies, USA) designed based on the highly conserved sequence of the 5.8s ribosomal RNA gene of L. zosterae known as internal transcribed spacer 1 (ITS) targeted by the TaqMan qPCR assay; an L. zosterae cell standard consisting of a sample of DNA extracted from a know quantity of pathogenic L. zosterae cells; and an inhibition control consisting of a half volume of L. zosterae cell standard and a half volume of a haphazardly selected sample. We ran a total of 31 96-well plates of qPCR reactions with a mean efficiency of 97.4% ± 4.3 and R2 0.996 ± 0.004.
Specifically, we first converted Ct values to copy numbers as our g-block standard curve were in units of copy number. We then used the L. zosterae cell standard to determine the copy number per L. zosterae cell. Finally, we converted copy number to L. zosterae cells * mg dw-1. Copy numbers per cell in our reactions were 1227.58 ± 80.66 (mean ± SE).
We used a pure culture of the pathogenic L. zosterae isolate 316b provided by D. Martin in 2015 to make our L. zosterae cell standard (Martin et al. 2016; GenBank: KU559372.1). We cultured L. zosterae cells on serum seawater agar media (Muehlstein et al. 1991). We scraped cells from an actively growing edge of L. zosterae culture into serum seawater liquid media (D. Martin pers. com.). We mixed the liquid media-L. zosterae cell slurry vigorously on a bench top vortex for 30 sec and aliquoted immediately into three replicate subsamples for cell counts and extraction. In order to break up cell clumps for ease of counting, we added Tween80 (Sigma-Aldrich, USA) to a final concentration of 1:100 into the two subsamples used for cell counts, and mixed for 30 sec. We counted cells of four replicate aliquots per subsample on a hemocytometer. We calculated cell concentration by averaging over all replicates. Prior to DNA extraction, we centrifuged the third replicate L. zosterae cell solution at 6,000 g for 10 min and drew off the supernatant without disturbing the cell pellet. We then added a ~4 mg section of dried healthy Z. marina tissue to the cell pellet to account for possible interference of Z. marina compounds in the extraction process. To extract L. zosterae DNA, we followed the DNA extraction and inhibitor removal protocols outlined above.
We designed the gBlock double stranded DNA fragments (Integrated DNA Technologies, USA) using published sequences of the ITS region of the L. zosterae genome (GenBank: JN121409-13).
5’-CTGTGATCTCTGAAAATACTTGTTT (1)TTGAACGTAACATTCGACTTTCGTCGATT TTG (2)TGGACGAGTGTGTTTTGT AAACCTACCC (3)AAGAAGACCGCTTCATGCGT GTCGCTGACTAATGAAACAAACAAA-3’
The gBlock fragment sequences were a total length of 130 bp, which included target regions for the forward (1) and reverse (3) primers and the MGD probe (2), underlined above, as well as 25 base pairs of additional sequence on both the 5’ and 3’ ends to increase fragment stability. We diluted gBlock fragments in Milli-Q H2O (Thermofisher, USA) to seven concentrations: 2.24e1, 1.12e2, 5.61e2, 2.81e3, 1.40e4, 7.02e4, 7.02e5 copies/µL and included this dilution series in each qPCR run as a standard curve (Bergmann et al. 2011). The range of the gBlock dilution curve: approx. 1-60,000 cells/extraction encompassed the range of most L. zosterae values observed in our samples: 0.15-450,000 cells/extraction or 1.84e2-5.52e8 copies/extraction.
Life Sciences Identifiers (LSID) for taxonomic names:
Zostera marina (urn:lsid:marinespecies.org:taxname:145795)
Labyrinthula zosterae (urn:lsid:marinespecies.org:taxname:395093)
Labyrinthula (urn:lsid:marinespecies.org:taxname:119090)
Data collected as part of the same experiment.
Data collected as part of the same experiment.
Data collected as part of the same experiment.
Schenck, F., DuBois, K., Kardish, M., Stachowicz, J. J., Hughes, A. R. (2022). Quantitative PCR cell count estimates from samples of DNA extracted from seagrass wasting disease parasite, Labyrinthula zosterae from wasting disease mesocosm experiments at Bodega Marine Laboratory in July-Sept of 2015. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2022-10-27 [if applicable, indicate subset used]. doi:10.26008/1912/bco-dmo.883055.1 [access date]
Terms of Use
This dataset is licensed under Creative Commons Attribution 4.0.
If you wish to use this dataset, it is highly recommended that you contact the original principal investigators (PI). Should the relevant PI be unavailable, please contact BCO-DMO (info@bco-dmo.org) for additional guidance. For general guidance please see the BCO-DMO Terms of Use document.