{"@context":{"content":"http:\/\/purl.org\/rss\/1.0\/modules\/content\/","dc":"http:\/\/purl.org\/dc\/terms\/","foaf":"http:\/\/xmlns.com\/foaf\/0.1\/","og":"http:\/\/ogp.me\/ns#","rdfs":"http:\/\/www.w3.org\/2000\/01\/rdf-schema#","sioc":"http:\/\/rdfs.org\/sioc\/ns#","sioct":"http:\/\/rdfs.org\/sioc\/types#","skos":"http:\/\/www.w3.org\/2004\/02\/skos\/core#","xsd":"http:\/\/www.w3.org\/2001\/XMLSchema#","owl":"http:\/\/www.w3.org\/2002\/07\/owl#","rdf":"http:\/\/www.w3.org\/1999\/02\/22-rdf-syntax-ns#","rss":"http:\/\/purl.org\/rss\/1.0\/","site":"https:\/\/www.bco-dmo.org\/ns#","odo":"http:\/\/ocean-data.org\/schema\/","emo":"http:\/\/ocean-data.org\/schema\/entity-matching#","bibo":"http:\/\/purl.org\/ontology\/bibo\/","crypto":"http:\/\/id.loc.gov\/vocabulary\/preservation\/cryptographicHashFunctions\/","bcodmo":"http:\/\/lod.bco-dmo.org\/id\/","tw":"http:\/\/tw.rpi.edu\/schema\/","dcat":"http:\/\/www.w3.org\/ns\/dcat#","time":"http:\/\/www.w3.org\/2006\/time#","geo":"http:\/\/www.w3.org\/2003\/01\/geo\/wgs84_pos#","geosparql":"http:\/\/www.opengis.net\/ont\/geosparql#","sf":"http:\/\/www.opengis.net\/ont\/sf#","void":"http:\/\/rdfs.org\/ns\/void#","sd":"http:\/\/www.w3.org\/ns\/sparql-service-description#","dctype":"http:\/\/purl.org\/dc\/dcmitype\/","prov":"http:\/\/www.w3.org\/ns\/prov#","schema":"http:\/\/schema.org\/","geolink":"http:\/\/schema.geolink.org\/1.0\/base\/main#","spdx":"http:\/\/spdx.org\/rdf\/terms#","bcodmo_vocab":"http:\/\/schema.bco-dmo.org\/"},"@id":"http:\/\/lod.bco-dmo.org\/id\/dataset\/798144#graph","@graph":[{"http:\/\/lod.bco-dmo.org\/id\/dataset\/798144":{"@id":"http:\/\/lod.bco-dmo.org\/id\/dataset\/798144","@type":["http:\/\/ocean-data.org\/schema\/DeploymentDatasetCollection","http:\/\/www.w3.org\/ns\/dcat#Dataset","http:\/\/ocean-data.org\/schema\/Dataset"],"http:\/\/ocean-data.org\/schema\/hasAcquisitionDescription":[{"@value":"
Methodology:<\/strong> We optimized a DNA extraction protocol for ultra-organic lean sediments that provided increased yields of DNA, enabling sequencing of 16S rRNA and ammonia monooxygenase [amoA] genes, as well as metagenomes, from two deep oxic subseafloor sediment cores reaching up to ~15 million years old. In addition, we demonstrate the viability of uncultivated microbial populations via \u00b9\u2078O-labeling in long-term (18-month) incubations in the presence of H\u2082\u00b9\u2078O, a method for identifying actively growing microbes.<\/p>\n Sampling and analytical procedures:<\/strong> All samples were taken by Cruise KN223 of the R\/V Knorr, in the North Atlantic, from October 26th 2014 - December 2014 (Woods Hole, MA - Woods Hole, MA). At both Site 11 (22\u00b0 47.0\u2019N, 56\u00b0 31.0\u2019 W, water depth ~5,600 m) and Site 12 (29\u00b0 40.6\u2019 N, 58\u00b0 19.7\u2019 W, water depth ~5,400 m), successively deeper subseafloor cores were taken with a multicorer [to ~0.4 meters below seafloor (mbsf)], a gravity corer (to ~3 mbsf), and the 45-m WHOI \"long corer\" piston-coring device (https:\/\/www2.whoi.edu\/site\/longcore\/<\/a>) (to ~28 mbsf). Subsamples from the core sections for DNA extraction were sampled on board the ship immediately after retrieval with sterile 60 mL syringes with the Luer taper end cut off and frozen immediately at -80 \u00b0C prior to DNA extraction. Subsamples for the 18O-labeling experiment were sampled from the core sections in the same manner, but were stored at +4 \u00b0C prior to incubation set up.<\/p>\n DNA extraction:<\/strong> Subcores sampled aseptically with sterile syringes were sampled aseptically in a UV-sterilized DNA\/RNA clean HEPA filtered laminar flow hood. To reduce contamination, the paraffin was removed and the outer 3 cm of sediment pushed out of the syringe, which was then sliced off with a red-hot, sterile spatula. A second unused, sterile, spatula was used to carefully sample the uncontaminated center of the remaining core sample inside the syringe. In brief, 10 g of sediment was transferred into 50 mL Lysing Matrix E tubes (MP Biomedicals) containing silica glass beads and homogenized for 40 sec at 6 m\/s using a FastPrep 24 5-G homogenizer (MP Biomedicals) in the presence of 15 mL preheated (65 C) sterile filtered extraction buffer (76 vol% vol 1M NaPO\u2084 pH 8, 15 vol% 200 proof ethanol, 8 vol% MoBio's lysis buffer solution C1, and 1 vol% SDS). The samples were incubated at 99\u00b0C for 2 minutes and frozen overnight at -20\u00b0C, thawed, and frozen again at -20\u00b0C overnight, followed by additional incubation at 99\u00b0C for 2 minutes and a second homogenization using the settings described above. The additional freeze thaw steps, particularly freezing overnight, was found to increase DNA yield 2\u201310 fold. After the second homogenization, the samples were centrifuged for 15 minutes, and the supernatants concentrated to a volume of 100 uL using 50 KDa Amicon centrifugal filters (Millipore). Co-extracted PCR-inhibiting humic acids and other compounds were removed from the concentrated extract using the PowerClean Pro DNA Clean-up Kit (MoBio). Extraction blanks were performed alongside the samples to assess laboratory contamination during the extraction process.<\/p>\n qPCR:<\/strong> DNA was quantified fluorometrically using a Qubit with a dsDNA high-sensititivity kit (Life Technologies). Quantitative PCR (qPCR) was performed using the custom primer dual indexed approach that targets the V4 hypervariable region of the 16S rRNA gene using updated 16S rRNA gene primers 515F\/806R (515F: 5' \u2013 GTGYCAGCMGCCGCGGTAA\u2013 3', 806R: GGACTACNVGGGTWTCTAAT) that increase coverage of ammonia oxidizing Thaumarchaea and other marine strains(59<\/em>). To measure the abundance of amoA genes from archaea, the primers Arch amoA-1F (STAATGGTCTGGCTTAGACG) and Arch amoA-2R (GCGGCCATCCATCTGTATGT) were used. qPCR reactions were prepared using an automated liquid handler (pipetting robot), the EpMotion 5070 (Eppendorf), was used to set up all qPCR reactions and standard curves. The efficiency values of the qPCR was <90% and R\u00b2 values >0.95. qPCR was performed using white 96-well plates as this was found to increase the signal to noise in the SYBR green assay 2-fold compared to clear plates. The technical variability of 16S rRNA gene qPCR measurements was determined to be consistently <5% under the the EpMotion 5070.<\/p>\n 16S rRNA and amoA gene sequencing:<\/strong> Barcoded V4 hypervariable regions of amplified 16S rRNA genes were sequenced on an Illumina MiniSeq. This yielded a total of >20,000,000 raw sequencing reads that were then subjected to quality control. In order to quality control the OTU picking algorithm for the data, we also sequenced a \"mock community\" alongside our environmental samples. The mock communities contained a defined number of species (n=18) all containing 16S rRNA genes >3% difference. USEARCH version 10.0.240 was used for quality control and OTU picking (61<\/em>), OTUs were clustered at 97% sequence identity. The taxonomic relationship of OTU representative sequences were identified by BLASTn searches against SILVA database (www.arb-silva.de<\/a>) version 128. To identify contaminants, 16S rRNA genes from extraction blanks and dust samples from the lab were also sequenced. These 16S rRNA gene sequences from contaminants were used to identify any contaminating bacteria in our oxic abyssal clay samples. All OTUs containing sequences from these 'contaminant' samples were removed prior to downstream analysis.<\/p>\n qPCR of 16S rRNA genes in DNA extraction blanks were consistently <10\u00b2 copies per extraction, and thus we used 10\u00b2 copies to define our detection limit for the abyssal clay samples. Consistent with this, high-throughput sequencing of amplicons with qPCR values <10\u00b2 copies per g sediment had up to 50% sequence representation from contaminant taxa, whereas samples with values >10\u00b2 copies per g sediment had <5% representation from contaminant taxa. This further supported our definition of <10\u00b2 as a realistic detection limit. Using samples that had 16S rRNA gene copies >10\u00b2 copies per g sediment, we were able to analyze microbial communities down to ca. 15 mbsf at Site 11 and ca. 8 mbsf at Site 12.<\/p>\n