| Data File(s) | Type | Description | Action |
|---|---|---|---|
cells_nitrate_data.csv (133.60 KB) | Comma Separated Values (.csv) | Primary data file for dataset ID 890887 |
Files
Type: Comma Separated Values (.csv)
Primary data file for dataset ID 890887
These data include picocyanobacteria (Prochlorococcus or Synechococcus) cell concentrations and nitrite (NO2-) concentrations during batch culture with ammonium (NH4+) or nitrate (NO3-) as the sole nitrogen source for growth. The study was focused on assessing the potential for picocyanobacteria to release nitrite during growth on nitrate due to incomplete assimilatory nitrate reduction. Both pure cultures and co-cultures were assessed.
Views
Downloads
These numbers come from web analytics and reflect real user activity on the site. Download counts include both page-based interactions and direct file downloads. They reliably show dataset usage and are mostly free of bot traffic.
Cultures: The strains used in this study included Prochlorococcus MIT0915, Prochlorococcus MIT0917, Prochlorococcus MIT1214, Prochlorococcus SB, Synechococcus WH7803, and Synechococcus WH8102. Except for MIT1214, all strains can grow on nitrate as the sole nitrogen source. MIT1214 can use nitrite, but not nitrate. All strains were routinely assayed for heterotrophic contaminants by staining cells with SYBR green and assessing the fluorescence and light scattering properties of both stained and unstained cells using a Guava easyCyte 12HT Flow Cytometer (MilliporeSigma, Burlington, MA, USA). Cultures that did not exhibit the presence of non-photosynthetic cells in the stained samples and had a single cyanobacteria population were presumed axenic and unialgal. All axenic cultures were routinely assessed for purity by confirming a lack of turbidity after inoculation into a panel of purity test broths as described previously (Berube et al., 2015).
Cultivation methods for pure cultures: The cultures were grown on Pro99 medium (Moore et al., 2007) with the sole nitrogen source provided as one of the following: 800 micromolar (µM) ammonium chloride (NH₄Cl), 800 µM sodium nitrate (NaNO₃), or 100 µM sodium nitrite (NaNO₂). Surface water from the Sargasso Sea was used as the natural seawater base for the Pro99 medium. The cultures were grown as duplicates or triplicates in 35 milliliters (mL) of medium in borosilicate glass culture tubes at a temperature of 24° Celsisus (C) under a range of light intensities under continuous illumination of white or blue light. Cultures were acclimated to each condition for at least 10 generations prior to starting the experiment.
Cultivation methods for co-cultures: MIT1214 was co-cultured with either MIT0915 or MIT0917 in 35 mL of Pro99 medium in borosilicate glass culture tubes with 800 µM of sodium nitrate as the sole nitrogen (N) source. The temperature and light conditions were 24°C and 16 micromoles photons per square meter per second (µmol photons m⁻² s⁻¹) of continuous blue light, respectively. The co-cultures were grown as triplicates and followed over 2 sequential transfers.
Sampling: Pure cultures were monitored daily by removing 0.5 mL of culture in order to determine total cell concentrations with flow cytometry and nitrite concentrations with the Griess colorimetric method. Co-cultures were treated the same as the pure cultures with sampling for quantitative PCR by filtering 1 mL of culture onto a 25 millimeter (mm) 0.2 micrometer (µm) pore size polycarbonate filter under low vacuum, chasing with 2 mL of qPCR preservation solution (10 millimolar (mM) Tris pH=8, 100 mM EDTA, and 500 mM NaCl), and then transferring the filter to a 2 mL beadbeater tube prior to storage at -80°C.
Nitrite concentration assay: Extracellular nitrite concentrations were determined via the Greiss colorimetric method that uses sequential additions of sulfanilamide and N-(1-naphthyl)ethylenediamine (NED) to produce a pink azo dye with a maximum absorption at a wavelength of 540 nanometers (nm). The following two solutions were prepared: (1) 0.010 grams per milliliter (g/mL) sulfanilamide in 0.6N HCl and (2) 0.001 g/mL NED. These reagent solutions were filtered through a 0.2 µm filter into UV-resistant bottles and stored at 4°C for up to one month. Aliquots of a 1 mM sodium nitrite (NaNO₂) standard solution was stored frozen at -20°C and thawed daily to prepare dilutions spanning 1-50 µM for the generation of a standard curve. To prepare samples for quantification of nitrite, a 0.15 mL aliquot of each culture was filtered through a 96-well 0.45 µm MultiScreenHTS HVfilter plate (MilliporeSigma, Burlington, MA, USA) capable of capturing >99% of cyanobacteria cells. Dilutions of the sodium nitrite standard were filtered in the same plate as the culture samples to ensure similar treatment. 100 microliters (µL) of filtrate was then transferred from each well to a flat-bottomed, 96-well microplate. The sulfanilamide reagent solution (50 µL) was added to each well, mixed by pipetting, and incubated in the dark for 10 minutes to allow for chromophore formation. Subsequently, The NED reagent solution (50 µL) was added to each well, mixed by pipetting, and incubated in the dark for an additional 10 minutes to allow for coupling and color development. Absorbance at 540 nm was then determined by using a Synergy 2 Plate Reader (BioTek Instruments, Winooski, VT, USA).
Total cell concentrations: Cell concentrations inclusive of total cyanobacteria cells in each culture were obtained by flow cytometry using a Guava easyCyte 12HT Flow Cytometer (MilliporeSigma, Burlington, MA, USA). Prochlorococcus and Synechococcus cells were detected based on the fluorescence of cellular pigments excited by a 488 nm laser. Cultures were first diluted to between 50 and 500 cells/µL and data were acquired for up to 6 min at a flow rate of 0.024 microliters per second (µL/s). Bead standards (Guava easyCheck beads; MilliporeSigma, Burlington, MA, USA), were run daily to confirm that the instrument was operating within normal parameters and within predefined tolerances for concentrations, scatter, and emission intensity of the beads.
Strain-specific cell concentrations: For MIT0915 and MIT0917, we used a previously developed quantitative PCR assay (Berube et al., 2016). For the detection of MIT1214 we designed quantitative PCR primers targeting the wcaK gene: MIT1214_wcaK_283F (5'-GACTACTGCATTTTCGCTGGG-3') and MIT1214_wcaK_402R (5'- ACCTTCAAAACCTCCAACACC). Samples used to generate standard curves were acquired by growing MIT0915, MIT0917, and MIT1214 to late-exponential phase (approximately 8 x 107 cells mL⁻¹), filtering 5 mL of culture onto a 25 mm 0.2 µm pore size polycarbonate filter under low vacuum, chasing with 3 mL of qPCR preservation solution (10 mM Tris pH=8, 100 mM EDTA, and 500 mM NaCl), and then transferring the filter to a 2 mL beadbeater tube prior to storage at -80°C. Cell concentrations for each culture, at the time of sample filtration, were obtained by flow cytometry. Templates for both experimental cultures and standards were generated by thawing the filters on ice for 2 minutes, adding 650 µL of 10 mM Tris pH=8, and then beadbeating at 4800 rotations per minute (rpm) for 2 minutes. Following beadbeating to remove cells from the filter, 500 µl of the buffer was transferred to a 1.5 mL centrifuge tube and heated at 95°C for 15 minutes to lyse cells. Templates for standard curves were generated by first diluting the resulting template solution to 5.4 x 105 cell equivalents µL-1 and then performing a serial dilution. All templates were stored at -80°C until use. The MIT1214 wcaK assay was performed in 25 µL reaction volumes with 2.5 µL template and the following final concentrations of reaction components: 12.5 µL QuantiTect SYBR Green PCR Mix (Qiagen, Germantown, Maryland) and 0.5 µmol L⁻¹ of each forward and reverse primer. Using a CFX96 Thermocycler (Bio-Rad, Hercules, CA, USA), reactions were pre-incubated at 95°C for 15 minutes to activate the polymerase and then cycled (40 cycles) at 95°C for 15 seconds (s), 57°C for 30 s, and 72°C for 30 s. The MIT0915 and MIT0917 narB assays were performed similarly, except for annealing at 60°C for 30 s (Berube et al., 2016). Amplification efficiencies were 85% for the MIT1214 wcaK assay, 90% for the MIT0915 narB assay, and 79% for the MIT0917 narB assay. Negative controls included MIT0915 and MIT0917 templates for the MIT1214 wcaK assay as well as MIT1214 templates for the narB assay; no amplification was observed in these negative controls.
Berube, P., Chisholm, S. W. (2023). Prochlorococcus or Synechococcus cell concentrations and nitrite concentrations during batch culture with ammonium or nitrate as the sole nitrogen source for growth. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2023-03-01 [if applicable, indicate subset used]. doi:10.26008/1912/bco-dmo.890887.1 [access date]
Terms of Use
This dataset is licensed under Creative Commons Attribution 4.0.
If you wish to use this dataset, it is highly recommended that you contact the original principal investigators (PI). Should the relevant PI be unavailable, please contact BCO-DMO (info@bco-dmo.org) for additional guidance. For general guidance please see the BCO-DMO Terms of Use document.